ID: 986595200

View in Genome Browser
Species Human (GRCh38)
Location 5:9414481-9414503
Sequence CTGCATAAATAGATGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 242}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986595197_986595200 -2 Left 986595197 5:9414460-9414482 CCAGTGGTCTGATTATGGATCCT 0: 1
1: 0
2: 0
3: 12
4: 100
Right 986595200 5:9414481-9414503 CTGCATAAATAGATGGAAATAGG 0: 1
1: 0
2: 1
3: 23
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986595200 Original CRISPR CTGCATAAATAGATGGAAAT AGG Intronic
904239298 1:29133782-29133804 CTTGTTAAATAGTTGGAAATGGG + Intergenic
904983804 1:34528075-34528097 GTGCATCAATAAATGGAATTGGG - Intergenic
905433439 1:37941041-37941063 CTGCAGTACTAGATGGAACTGGG + Intronic
906530518 1:46521133-46521155 ATACATAAATAAATAGAAATGGG - Intergenic
906930569 1:50165622-50165644 ATGCATAAATATATGTATATAGG + Intronic
907310862 1:53538298-53538320 CTGCATACATGAATGGAAAGTGG + Intronic
907487411 1:54787435-54787457 GACCATAAATAGGTGGAAATAGG + Intronic
908679766 1:66647751-66647773 CTGCATAAACAGAGGGACACTGG - Intronic
909490892 1:76225282-76225304 CTGCATCTATATATAGAAATGGG - Intronic
910027468 1:82673641-82673663 TTTCATACATAGATTGAAATGGG - Intergenic
913345168 1:117801836-117801858 CTACATAAATATATGCTAATGGG + Intergenic
921281556 1:213572785-213572807 CTTCATAAAGAGATAAAAATTGG + Intergenic
921951651 1:220936430-220936452 CTTCAGATATAGAAGGAAATTGG - Intergenic
923486335 1:234435090-234435112 CTGCTTAAAGAGAAGGACATAGG + Intronic
1064495596 10:15906599-15906621 ATATATTAATAGATGGAAATGGG - Intergenic
1065094186 10:22264415-22264437 ATACATAGATAGATGGATATGGG + Intergenic
1066283253 10:33938915-33938937 CTGCAGGAAGAAATGGAAATGGG - Intergenic
1068101913 10:52565803-52565825 CTGCATTAGTAGTTTGAAATGGG + Intergenic
1073625499 10:105091597-105091619 ATCCTTAAATAGATGTAAATCGG + Intronic
1074273142 10:111974857-111974879 CTGAATAAATTAATGGCAATGGG + Intergenic
1074450263 10:113553672-113553694 CTGCATAAATAGTTTGGATTTGG + Intronic
1079343493 11:19632185-19632207 CCCTATAAATAGATGGTAATGGG - Intronic
1080293832 11:30702253-30702275 CTGTATAAAAACATGGAAATTGG - Intergenic
1080738165 11:35037722-35037744 CTGCAGGTATACATGGAAATAGG + Intergenic
1083385241 11:62303934-62303956 CTGCACAACTACATGGAAACTGG - Intergenic
1084850636 11:71936897-71936919 CTCAATAAATATATGGATATGGG - Intronic
1084994142 11:72958888-72958910 CTGTTTCCATAGATGGAAATGGG - Intronic
1085550690 11:77368141-77368163 CAGTATAAATAGATGTAAATAGG + Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1088229996 11:107663849-107663871 CTGCATGCATAAATGAAAATGGG - Intronic
1090321299 11:125845631-125845653 ATGGATAAATTGATGGAAGTAGG + Intergenic
1090555182 11:127866983-127867005 CTGCATAAATAATTGAAAAGTGG - Intergenic
1094704712 12:32903308-32903330 CTGTATATATTGATGGATATAGG + Intergenic
1094725430 12:33109464-33109486 CTGCACAACTACATGGAAACTGG + Intergenic
1095192597 12:39274662-39274684 CTGCAGAAATGGGTAGAAATGGG - Intergenic
1095240158 12:39848660-39848682 CTGCATATATACCTAGAAATGGG - Intronic
1095310929 12:40695542-40695564 ATGTAGAAATAGATGGAAATTGG - Intronic
1097471357 12:59996756-59996778 CTGCATAATTAGATAATAATGGG + Intergenic
1098426367 12:70369182-70369204 CTGGATAAAGAGATATAAATTGG - Intronic
1100605453 12:96148765-96148787 CTGGAAAAATAGATGGAATGAGG + Intergenic
1105282462 13:18975798-18975820 CTGCAGAAACAAATGCAAATAGG + Intergenic
1106401919 13:29439393-29439415 CAGCATCAATAGATGAAAAAAGG - Intronic
1106848085 13:33759425-33759447 CTGCATTGATAGAGGGAAATGGG - Intergenic
1107451873 13:40517117-40517139 CTGCACGAAGAGATGGAAATTGG + Intergenic
1107525136 13:41222970-41222992 CTGCATATATACATGGGTATTGG - Intronic
1108980602 13:56507914-56507936 TGGCAGAAAAAGATGGAAATAGG - Intergenic
1109286473 13:60414928-60414950 CTGCTTAAACAGAGGGAAAAGGG + Intronic
1109433318 13:62265776-62265798 CAGTATAAAAAGATGAAAATGGG + Intergenic
1110024798 13:70523003-70523025 CTTCAAAAATACATGGAAAATGG + Intergenic
1113049166 13:106189370-106189392 CTGCTTAAATTGATCAAAATGGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114758466 14:25285319-25285341 CTGCATAAATTATTGGTAATGGG + Intergenic
1115075628 14:29386420-29386442 CTGCATACATAGATATAAAGGGG - Intergenic
1115961700 14:38841279-38841301 CTGCATAAATATTAGCAAATTGG + Intergenic
1116833517 14:49746256-49746278 ATGCTTAAATATATGGAAAGAGG + Intronic
1117765374 14:59076319-59076341 CTCCATATATAGATGCAGATGGG - Intergenic
1118740674 14:68737259-68737281 CTGCAGAAATAGCTAGCAATTGG + Intergenic
1118740777 14:68737877-68737899 CTGCAGAAATAGCTAGAGATTGG - Intergenic
1119125222 14:72119147-72119169 TTGCCTAAATAGATGTAAAAAGG + Intronic
1119343010 14:73896795-73896817 CAACATAAATAGGTGCAAATTGG - Intronic
1119973151 14:78995143-78995165 CTGCATAAAAACATAGAACTGGG + Intronic
1120313751 14:82865352-82865374 ATGCATACATACATGTAAATAGG + Intergenic
1120587082 14:86325586-86325608 CTGCATATGTAGAGAGAAATAGG + Intergenic
1120778613 14:88464765-88464787 TTGCATAAAGAAATGGAAACAGG - Intronic
1122301895 14:100736206-100736228 TTGCAAAAATAGAAAGAAATGGG + Exonic
1123148887 14:106162026-106162048 CTGCACAACTACATGGAAACTGG + Intergenic
1125072125 15:35567570-35567592 CTGCAGAAATTGATGGCAATTGG + Intergenic
1130215693 15:81966874-81966896 CTACATAAACAAATGTAAATGGG + Intergenic
1131708838 15:95030278-95030300 CTGAATACATATATTGAAATTGG - Intergenic
1131971835 15:97901300-97901322 CTGCATAAAGAAATGGAAATGGG - Intergenic
1134848590 16:17461684-17461706 ATGCATAAATAGATGGAGGCAGG + Intronic
1137392045 16:48089548-48089570 CTGTGTAAACAGCTGGAAATAGG + Intronic
1138704399 16:58899394-58899416 TTGCATAAATTGATGGATTTGGG - Intergenic
1138956327 16:61974803-61974825 CTGCCCAAGTAGATGGAATTGGG - Intronic
1140153672 16:72400027-72400049 ATAAATAAATAGATGGAAATAGG - Intergenic
1140935517 16:79666129-79666151 CTGCCTAAATCTATGCAAATTGG + Intergenic
1142493669 17:294572-294594 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493708 17:294820-294842 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493723 17:294929-294951 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493763 17:295178-295200 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493798 17:295397-295419 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493807 17:295452-295474 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493840 17:295670-295692 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493873 17:295888-295910 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493909 17:296107-296129 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493928 17:296217-296239 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493937 17:296272-296294 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493946 17:296327-296349 CTGCAGAAATGGATGGACAGAGG + Intronic
1142493955 17:296382-296404 CTGCAGAAATGGATGGACAGAGG + Intronic
1143752584 17:9040086-9040108 CTGCAGATATAGATGTAAAGTGG - Intronic
1146097432 17:29945009-29945031 CTGCATAATTATGTGGAATTTGG - Intronic
1146264216 17:31440898-31440920 GTGCATTAATTGAAGGAAATTGG + Intronic
1146943103 17:36857421-36857443 CTGTAAGAATAGATGGAGATGGG - Intergenic
1149196111 17:54123170-54123192 TTTCATAAGTAGATGAAAATAGG + Intergenic
1149255669 17:54823529-54823551 CTGCACAACTACATGGAAACTGG + Intergenic
1149372981 17:56013828-56013850 CTCCATGAATAGATTGAAGTAGG + Intergenic
1153865045 18:9259746-9259768 CTGCAGTAATATATGCAAATTGG - Intronic
1153980349 18:10303428-10303450 CTGCAGAAGTAGAGAGAAATGGG - Intergenic
1155257112 18:24008415-24008437 CTGCATAAACAGAAGGCAAATGG - Intronic
1155272656 18:24155861-24155883 CAGCATAAACTGATGGAAACTGG - Exonic
1155384008 18:25257268-25257290 TTGAAAAAATAGATTGAAATGGG - Intronic
1155549824 18:26953270-26953292 CTTCAAAAATGGATGGAAGTTGG + Intronic
1156297647 18:35807317-35807339 CTGCAGAAAGAGATATAAATGGG - Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1159133292 18:64306222-64306244 GTGAATAAATAGATGGAAGGGGG + Intergenic
1159266251 18:66083798-66083820 CTGCATAAACTGACGGCAATTGG - Intergenic
1160358951 18:78254004-78254026 CTTCATAAATAAATGTATATAGG - Intergenic
1161559712 19:4965887-4965909 CTGCATTAACAAATTGAAATGGG - Intergenic
1167233785 19:48301773-48301795 CTGCATGGATGGATGGACATGGG + Intronic
1167233818 19:48301943-48301965 CTGGATAGATAGATGGATATGGG + Intronic
1167233864 19:48302196-48302218 CTGGATAGATAGATGGATATGGG + Intronic
1167960620 19:53102205-53102227 AGGCAGAAATAGATGGAGATTGG - Intronic
1167971729 19:53192179-53192201 AGGCAGAAATAGATGGAGATTGG - Intronic
1168190727 19:54736782-54736804 CTGCATCTTTGGATGGAAATTGG - Intronic
1168192962 19:54753202-54753224 CTGCATCTTTGGATGGAAATTGG - Intronic
1168200867 19:54814663-54814685 CTGCATCTTTGGATGGAAATTGG - Intronic
1168203097 19:54830929-54830951 CTGCATCTTTGGATGGAAATTGG - Intronic
1168208120 19:54867357-54867379 CTGCATCTTTGGATGGAAATTGG - Intergenic
925883685 2:8375353-8375375 CAACATAAAAAGATAGAAATGGG - Intergenic
926719307 2:15947518-15947540 CAGAATAAACAGATGGAAATGGG + Intergenic
926972551 2:18481377-18481399 CTAAACAAATAGATGTAAATGGG - Intergenic
927229362 2:20805334-20805356 CTTTATAAATACATGGAATTAGG - Intronic
927277996 2:21278113-21278135 CTGTAAAAATAGAGGGCAATAGG - Intergenic
927416468 2:22885866-22885888 CTCCACAAATACATGGAAAGGGG - Intergenic
930772671 2:55143425-55143447 CTGGATAAATACCTAGAAATAGG - Intergenic
931128432 2:59303674-59303696 CTGCATAAATATAGTGAAAGAGG + Intergenic
931528272 2:63183411-63183433 CTATACAAATACATGGAAATTGG - Intronic
933935264 2:87198794-87198816 CTACTTAGATAGATAGAAATAGG + Intergenic
935188998 2:100760835-100760857 CTTCAGAAATAGGAGGAAATGGG - Intergenic
935796618 2:106647905-106647927 CTGCATATGTAGCTGGACATAGG - Intergenic
936357884 2:111767105-111767127 CTACTTAGATAGATAGAAATAGG - Intronic
939421536 2:141977197-141977219 CTGGATAATAAGATAGAAATAGG - Intronic
939819510 2:146938988-146939010 CTGCATAGAGAGGGGGAAATTGG - Intergenic
939968372 2:148633404-148633426 GCCCATAAATAGATGGAGATTGG + Intergenic
941516264 2:166483166-166483188 CAGCAGAAGTATATGGAAATGGG + Intronic
942964081 2:181868693-181868715 GTGTTTAAATACATGGAAATGGG - Intergenic
945867482 2:215192808-215192830 CTATATAGATAGATGGAAATGGG + Intergenic
946284734 2:218694403-218694425 CTCCAGAAACAGATGCAAATTGG - Intronic
947017327 2:225635730-225635752 CTGCATTTATAGATGGAATTTGG + Intronic
947492397 2:230606479-230606501 CTGCACAACTACATGGAAACTGG + Intergenic
1169944625 20:10975458-10975480 CAGCATAAATAGATTAAGATAGG - Intergenic
1170076560 20:12425958-12425980 CTGCACAACTATATGGAAACTGG - Intergenic
1170803678 20:19611491-19611513 CTGGACAAATGGATGGAAATGGG + Intronic
1170886163 20:20341465-20341487 CTGCATAAATAAATTAAATTTGG - Intronic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1174093645 20:48069972-48069994 TTGCTTCAAAAGATGGAAATTGG + Intergenic
1175152659 20:56947237-56947259 CTGGATAATGGGATGGAAATGGG + Intergenic
1177448372 21:21230368-21230390 CTGTATAAAAAGATAAAAATTGG + Intronic
1177717748 21:24861778-24861800 CTTCAAAAATATATGAAAATGGG + Intergenic
1177969214 21:27767412-27767434 CTACTTAAATAGGTGTAAATAGG - Intergenic
1179113526 21:38468338-38468360 CTGAATATAGAGAGGGAAATTGG + Intronic
1179118108 21:38513581-38513603 CTGCATAAAGAGATGGCTGTGGG + Intronic
1179122977 21:38565887-38565909 CTGAATGATTAGATTGAAATTGG + Intronic
1179936254 21:44606184-44606206 CTACATAAATAAATAAAAATGGG + Intronic
1180351944 22:11813040-11813062 ATTCATAAATAGCTAGAAATGGG + Intergenic
1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG + Intergenic
1182743952 22:32590780-32590802 CCAAATAAATAGATGAAAATAGG - Intronic
1183596894 22:38818246-38818268 CTGCATAAATCCTGGGAAATGGG + Intergenic
951779149 3:26343484-26343506 ATGCATAAATAGAGGGTAAAAGG - Intergenic
951806492 3:26649928-26649950 CTGGATAAGTAGAGGGAAAGAGG - Intronic
951843566 3:27061408-27061430 CTGCCCAATTAGATGGAAAAGGG - Intergenic
954904489 3:54048510-54048532 CAGCATAAATGGATGGAAACTGG + Intergenic
956390081 3:68762445-68762467 CTGAATAGGTAGAAGGAAATGGG + Intronic
956905930 3:73765133-73765155 TTGGATAAATATATGGAAGTGGG - Intergenic
957720289 3:83986954-83986976 CTGCAGTAATAGATTGAATTTGG - Intergenic
958884879 3:99714613-99714635 ATGGATAAATGGATGGAAACAGG - Intronic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
960803761 3:121563458-121563480 ATGCATAAATAAATGAAAGTTGG + Intergenic
962185537 3:133255278-133255300 CTGAAACAAAAGATGGAAATAGG + Intronic
963777551 3:149454317-149454339 CTGGAAACATAGAAGGAAATAGG - Intergenic
964430486 3:156600682-156600704 CTGCCTAGATTGATGGAAATGGG + Intergenic
964863851 3:161231904-161231926 ATGCATAACCATATGGAAATTGG + Intronic
965348689 3:167585980-167586002 CTGGATGGATAGATGGAAGTCGG + Intronic
967402574 3:189080410-189080432 CTGCAAAAATACACAGAAATAGG + Intronic
971766686 4:30841597-30841619 AAGCACAAATAGATGGAAATAGG + Intronic
972143585 4:35992953-35992975 CTGCAAAAATAAATGGTAGTTGG - Intronic
972566134 4:40270759-40270781 TTGCATAAGAAGATGCAAATAGG + Intergenic
974703828 4:65486276-65486298 CTTCATATAGAGAGGGAAATGGG - Intronic
974777304 4:66501681-66501703 TTGCATAAATATATGGCAATTGG - Intergenic
975464714 4:74696346-74696368 CTACATAAACAGATGGGTATGGG + Intergenic
977245686 4:94628640-94628662 TTGTATAAATAGTTGAAAATTGG + Intronic
977531625 4:98207357-98207379 CTGCATTAATGGATGTAAATTGG + Intergenic
978010323 4:103674406-103674428 CTGTGGAAATAGATGGAAGTAGG + Intronic
978408444 4:108404157-108404179 CTGCATGACCAGATTGAAATTGG + Intergenic
979150915 4:117313002-117313024 TTGTATAAATATATAGAAATTGG + Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981672671 4:147305121-147305143 TTTCCTAAACAGATGGAAATGGG - Intergenic
982220122 4:153117156-153117178 CTTCATAAATTGTAGGAAATTGG - Intergenic
982263008 4:153511656-153511678 ATACATATATAGATGGAAAAAGG - Intronic
984107781 4:175571657-175571679 CTCCATAAATACATGTAAACGGG + Intergenic
986064958 5:4226540-4226562 ATGAAGAAAGAGATGGAAATAGG - Intergenic
986595200 5:9414481-9414503 CTGCATAAATAGATGGAAATAGG + Intronic
987603151 5:20099511-20099533 GTGGATAAAAAGATGAAAATGGG - Intronic
987946884 5:24621290-24621312 ATGAATAAATAAATGGATATGGG - Intronic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
989045423 5:37269054-37269076 CTGCATAAATTGTTGGTAATGGG + Intergenic
990205846 5:53428683-53428705 CTACATAAATGGATGGATAGAGG + Intergenic
990575835 5:57122571-57122593 TTTCAAAAATAGATAGAAATAGG + Intergenic
990955790 5:61336978-61337000 TTACATAAAGAGATGCAAATAGG + Intronic
991169325 5:63602930-63602952 CTGCTAAAATAGATTGAAATAGG - Intergenic
992408230 5:76479706-76479728 CTGCACAAATAGATTTAAGTAGG + Intronic
993024507 5:82630226-82630248 CCTCATAAATAGATGTAATTAGG + Intergenic
993132123 5:83912101-83912123 CTGAATAATTAGAAGGAAAAAGG - Intergenic
993184509 5:84600428-84600450 CTGAATGAAGAGCTGGAAATGGG + Intergenic
994504348 5:100622561-100622583 ATAAATAAATAGATGGCAATGGG - Intergenic
995766745 5:115627056-115627078 CTCCATAAATATATGTAAAATGG - Intronic
995916533 5:117252811-117252833 CAGCATTAATAGATAGAAAAAGG + Intergenic
996225427 5:120987776-120987798 CTGTACAAATAAATGAAAATAGG - Intergenic
999259610 5:150229784-150229806 TTGCATAAAAGCATGGAAATAGG - Intronic
999666805 5:153921287-153921309 CTTCATAAATGAAGGGAAATGGG - Intergenic
1001139039 5:169128164-169128186 AAGCATAAATAGAAGAAAATAGG + Intronic
1002819944 6:715599-715621 ATGCATAAACAGATGGAAAATGG + Intergenic
1003990623 6:11482922-11482944 CTGCATAAATATTTAAAAATTGG + Intergenic
1004681782 6:17902861-17902883 CTACATGAATAGATGGGATTGGG - Intronic
1005795223 6:29353339-29353361 CTGAATAAATATATGAACATGGG - Intergenic
1008028538 6:46666639-46666661 CTGAGTAAATAGCTGGAACTTGG - Intronic
1008548757 6:52606909-52606931 CAGCATTAATAAATTGAAATAGG - Intergenic
1008575234 6:52854313-52854335 CTGCACAACTACATGGAAACTGG - Intronic
1010012519 6:71065748-71065770 CTTAAAAAATACATGGAAATTGG - Intergenic
1013784464 6:113764334-113764356 CAGCAACAACAGATGGAAATGGG + Intergenic
1014310786 6:119798693-119798715 CTACAGAAATAAATGCAAATGGG - Intergenic
1015510095 6:134029947-134029969 CATCATAAATAGAAGGAAACTGG - Intronic
1018186670 6:161271116-161271138 AAGCATAAGTAGATGTAAATTGG - Intronic
1018563467 6:165126622-165126644 ATGCAAAAATAAATGGAAAATGG + Intergenic
1018943786 6:168330023-168330045 CTGCATAAAGACATGGTAATTGG + Intergenic
1020833232 7:13116638-13116660 CTGAAGAAAGAGATGGAAAATGG - Intergenic
1021178783 7:17482048-17482070 CCACATAAATAGCTTGAAATAGG - Intergenic
1025851655 7:65249514-65249536 ATGTATGAAAAGATGGAAATGGG + Intergenic
1027963572 7:84977754-84977776 CTTCAAAAATACATAGAAATAGG + Intergenic
1028431646 7:90754053-90754075 CTGCATCAATAGATTGCATTGGG - Intronic
1029952128 7:104597688-104597710 TTGCATATATTGATTGAAATAGG - Intronic
1030845920 7:114411046-114411068 ATGCATACATAAATGGCAATGGG + Intronic
1031168799 7:118264814-118264836 CTGCAAAAATAAAGGGAAAATGG + Intergenic
1031723956 7:125212791-125212813 CTGCATCAATAGAAGGAGCTTGG + Intergenic
1037105979 8:15108956-15108978 CTGCAAAAATAGAATGAAATTGG + Intronic
1038599223 8:28922081-28922103 CTGCATAAATCCATGGATGTGGG - Intronic
1039332465 8:36553582-36553604 CTACATCAAAAGAAGGAAATGGG + Intergenic
1040042000 8:42925562-42925584 CTGCATATTTTGATGAAAATTGG + Exonic
1041481481 8:58324831-58324853 CTACAAAAAGAGAAGGAAATGGG + Intergenic
1041745084 8:61199793-61199815 CTACATAAAAAGGTGGAAAGTGG - Intronic
1042663880 8:71184732-71184754 CTGGATAAATTCACGGAAATTGG + Intergenic
1046824503 8:118672576-118672598 CTTCATACACTGATGGAAATTGG - Intergenic
1047662350 8:127051285-127051307 CTGCATAAATAAATGTAACCTGG + Intergenic
1048245419 8:132791790-132791812 CTACATAAATATCTAGAAATTGG - Intronic
1048570266 8:135647663-135647685 CTTCATAAATAGTTGTAAACAGG + Intronic
1048731959 8:137452262-137452284 GTGCAGAAATAGATGGCCATTGG - Intergenic
1050314353 9:4385989-4386011 TGCCATAAATAGATGGGAATAGG - Intergenic
1051036712 9:12756060-12756082 CTACATGAATAGATGGAAGCAGG - Intergenic
1052018054 9:23492376-23492398 CTCTGTAAATCGATGGAAATAGG - Intergenic
1052527047 9:29631362-29631384 GTGCAAAAAGAGATGGAAAAGGG - Intergenic
1055473864 9:76642171-76642193 CTGCATAAATAAAAGCAAAGAGG - Intronic
1055984826 9:82047197-82047219 CAGTATAAAAAGATGTAAATTGG - Intergenic
1056265711 9:84894858-84894880 CTCAATAGATAGAGGGAAATTGG + Intronic
1056710492 9:88989112-88989134 CTCCATAAAAAAATGGAAAATGG + Intergenic
1057567641 9:96179398-96179420 ATACATAAATAGAAGAAAATGGG + Intergenic
1057665576 9:97042463-97042485 GTGTATAAATAGATATAAATAGG - Intergenic
1058595953 9:106615836-106615858 CTGCATAAGCAGATGAAAAAAGG + Intergenic
1059072918 9:111158328-111158350 CTTCATAATTAGGGGGAAATGGG + Intergenic
1186447224 X:9641847-9641869 ATGCATCAGTTGATGGAAATTGG + Intronic
1187753936 X:22499268-22499290 CTGCAAAAATAGATGTTACTGGG + Intergenic
1193515817 X:82461839-82461861 TTGCAGAAATAAATGGATATAGG + Intergenic
1193624809 X:83804919-83804941 TTGGATAAATATCTGGAAATGGG - Intergenic
1195699983 X:107697639-107697661 ATGCAAAGATAGATGGATATTGG - Intergenic
1197662220 X:129186624-129186646 CTCCATAAAAATATGGAATTCGG - Intergenic
1199595760 X:149504818-149504840 ATGGATGAATAGATGGAAAGAGG + Intronic
1200759280 Y:7022676-7022698 ATGCATCAGTTGATGGAAATTGG + Intronic
1201737631 Y:17286405-17286427 CTGAAGAAATACATGGAACTGGG - Intergenic