ID: 986595966

View in Genome Browser
Species Human (GRCh38)
Location 5:9422286-9422308
Sequence CCAATTTAAATGCGTTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986595966_986595969 17 Left 986595966 5:9422286-9422308 CCTGGGCAACGCATTTAAATTGG 0: 1
1: 0
2: 0
3: 6
4: 63
Right 986595969 5:9422326-9422348 TGTTACTCTCTGCTGTCCATAGG 0: 1
1: 0
2: 0
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986595966 Original CRISPR CCAATTTAAATGCGTTGCCC AGG (reversed) Intronic
908478004 1:64507824-64507846 CAACTTTAAATGATTTGCCCAGG - Intronic
917422087 1:174874385-174874407 CGAAGTTAAATGACTTGCCCGGG + Intronic
921722267 1:218486317-218486339 CAAATTTAAATGCCTTAGCCTGG + Intergenic
924825367 1:247532651-247532673 ACAATTTCACTGTGTTGCCCGGG + Intronic
1064606354 10:17045063-17045085 CCAGTTCAAATGCGCTGCCGTGG + Exonic
1065264633 10:23962093-23962115 CCATTACAAATGTGTTGCCCTGG + Intronic
1068129603 10:52881351-52881373 CCCCTTTAAATGCCTTGGCCTGG + Intergenic
1082006811 11:47423867-47423889 AGAGTTTAAATGCCTTGCCCAGG - Intronic
1088304189 11:108390602-108390624 CCATTTTGAATGAGTTTCCCAGG - Intronic
1091883312 12:3997474-3997496 CCACTTTAAAGGCCTTTCCCAGG - Intergenic
1095754053 12:45743384-45743406 CAAATTTTACTGTGTTGCCCAGG + Intronic
1096308887 12:50503534-50503556 ACAGTTTCACTGCGTTGCCCAGG + Intergenic
1097754898 12:63398455-63398477 CCAATTCAAATGGGTGCCCCTGG - Intergenic
1102733581 12:115136996-115137018 CCAATTCAATTTCTTTGCCCTGG + Intergenic
1107353991 13:39546338-39546360 CCAATTTGTAGGCATTGCCCAGG - Intronic
1108020815 13:46126155-46126177 GCAATTGAAATGCATTGCTCTGG - Exonic
1108789179 13:53945975-53945997 CAAATTCAAATGATTTGCCCAGG + Intergenic
1122219234 14:100225473-100225495 CCAATATAAATGAGGTACCCAGG + Intergenic
1122666917 14:103336273-103336295 ACTCTTTAAATGCGTTCCCCTGG - Intronic
1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG + Intronic
1126362600 15:47861648-47861670 ACAATTTAAATGCGTACCCCGGG + Intergenic
1128787904 15:70411838-70411860 GCAATGTAAATGACTTGCCCAGG + Intergenic
1130925050 15:88379024-88379046 CCAGGTCACATGCGTTGCCCTGG + Intergenic
1138684344 16:58711586-58711608 CCAATTTAAAAACGTTTCACTGG - Intronic
1139158132 16:64469066-64469088 CCTATTTAAATGCTTTGCCATGG - Intergenic
1140424424 16:74848831-74848853 CCTAGTTAAGAGCGTTGCCCAGG - Intergenic
1143347077 17:6257718-6257740 CCTATTGAACTGCGTTGCTCTGG - Intergenic
1144251182 17:13418406-13418428 ACCATTTAAATGCATTTCCCTGG + Intergenic
1161762788 19:6186886-6186908 CCAATTTCACTGTGTTGCCCAGG + Intronic
939973330 2:148687254-148687276 AGAATTGAAATGCCTTGCCCTGG + Intronic
943218195 2:185066691-185066713 GCAATTTAAATGGGGTGACCAGG - Intergenic
943619173 2:190128549-190128571 CTGATTTAAATGGGCTGCCCTGG - Intronic
948909480 2:240995806-240995828 GCAATTTAGATGGGGTGCCCCGG - Intergenic
1172007764 20:31829171-31829193 CCAATTAAAATGCAGTGCTCTGG + Intronic
1178514780 21:33237229-33237251 CAAATATAAAGGGGTTGCCCTGG + Intronic
1178811106 21:35882228-35882250 CGAGGTTAAATGCTTTGCCCAGG - Intronic
1179042900 21:37820081-37820103 CCAATTTAAAAGAGTGGGCCAGG - Intronic
952055497 3:29440125-29440147 ACAATTTAAATGTGTTTCCAGGG - Intronic
954423483 3:50431092-50431114 CCAATTTAAATCCTTTGCTCTGG - Intronic
954603121 3:51887751-51887773 CCAATTTGAATGCGGTGGTCAGG + Intergenic
965806069 3:172543100-172543122 AGAAGTTAAATGCCTTGCCCAGG - Intergenic
967758874 3:193201690-193201712 CTCATTTAAATGCGTTGCCATGG + Intergenic
970568016 4:17351499-17351521 CCAATTAAAATGCATCTCCCAGG + Intergenic
978962128 4:114692925-114692947 CCAATTTAAATTGGTTGATCAGG - Intergenic
980747699 4:137041110-137041132 CCAATTTAAATGTGTTACTTAGG + Intergenic
986369715 5:7068170-7068192 CAAATATAAATGCATTTCCCAGG + Intergenic
986595966 5:9422286-9422308 CCAATTTAAATGCGTTGCCCAGG - Intronic
991411557 5:66351259-66351281 ACAAGTTAAATGATTTGCCCAGG + Intergenic
992140726 5:73794308-73794330 CAAGTGTAAATGAGTTGCCCAGG - Intronic
1001201052 5:169717283-169717305 CCCATTAAAATCCTTTGCCCAGG - Intronic
1001995946 5:176158302-176158324 CCAATTTAAATAAGATTCCCTGG + Intergenic
1002156603 5:177286216-177286238 ACAATTTAAATGTGTTGTCCAGG + Intronic
1003802039 6:9680973-9680995 CCATTTTAAAGGCCCTGCCCTGG + Intronic
1003941847 6:11036525-11036547 CCATTTCGACTGCGTTGCCCCGG + Intronic
1004118816 6:12798562-12798584 CCAATTTAAAGTCAGTGCCCGGG + Intronic
1005257841 6:24023364-24023386 CCAATTTAAAGTCTTTTCCCTGG - Intergenic
1007707642 6:43800551-43800573 CCATTTTAAATAGGATGCCCAGG - Intergenic
1013274961 6:108575528-108575550 CTAATTTAAAAGCGTTGCGATGG + Intronic
1015864229 6:137711522-137711544 CCATTTTAAATACGATGCTCAGG + Intergenic
1018410662 6:163543549-163543571 CCAACCTAAATGAGTTGCCATGG + Intronic
1033766647 7:144500221-144500243 CCAATCTTTATGCGTGGCCCTGG - Intronic
1033830881 7:145250925-145250947 TCCATTTAAATGAGTAGCCCAGG + Intergenic
1048192135 8:132299672-132299694 CCAAATTAAATGACATGCCCTGG + Intronic
1048361444 8:133700545-133700567 CCAATGTAAATTCTTTTCCCAGG - Intergenic
1049407004 8:142456045-142456067 CCCATTGAAATGCGTTCCTCTGG - Intronic
1052923031 9:33988056-33988078 CAAATTTAAGTGGGTTGCCAAGG - Intronic
1053456045 9:38233790-38233812 CCAGTGTAAATGACTTGCCCAGG - Intergenic
1186460136 X:9741693-9741715 CAAATTTCACTGTGTTGCCCAGG - Intronic
1195530452 X:105948649-105948671 GCAATTTTAATGCGTTCCCTGGG - Intronic
1199720493 X:150539892-150539914 CCACTTTGAGTGCCTTGCCCTGG - Intergenic