ID: 986597507

View in Genome Browser
Species Human (GRCh38)
Location 5:9439064-9439086
Sequence GCTGCTGGGGCGTCTCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17860
Summary {0: 1, 1: 0, 2: 13, 3: 1060, 4: 16786}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986597507_986597515 5 Left 986597507 5:9439064-9439086 CCTGCCTGAGACGCCCCAGCAGC 0: 1
1: 0
2: 13
3: 1060
4: 16786
Right 986597515 5:9439092-9439114 CACCCTCATATCGTGCAGCACGG 0: 1
1: 0
2: 0
3: 2
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986597507 Original CRISPR GCTGCTGGGGCGTCTCAGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr