ID: 986597638

View in Genome Browser
Species Human (GRCh38)
Location 5:9440054-9440076
Sequence GTGAGCACCCTGTCTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986597638_986597641 0 Left 986597638 5:9440054-9440076 CCTGGGGAAGACAGGGTGCTCAC 0: 1
1: 0
2: 0
3: 21
4: 185
Right 986597641 5:9440077-9440099 CAACACACCCATGTGTGCCTGGG 0: 1
1: 0
2: 1
3: 8
4: 141
986597638_986597644 14 Left 986597638 5:9440054-9440076 CCTGGGGAAGACAGGGTGCTCAC 0: 1
1: 0
2: 0
3: 21
4: 185
Right 986597644 5:9440091-9440113 GTGCCTGGGAACGTGCACTCAGG 0: 1
1: 0
2: 2
3: 10
4: 138
986597638_986597640 -1 Left 986597638 5:9440054-9440076 CCTGGGGAAGACAGGGTGCTCAC 0: 1
1: 0
2: 0
3: 21
4: 185
Right 986597640 5:9440076-9440098 CCAACACACCCATGTGTGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986597638 Original CRISPR GTGAGCACCCTGTCTTCCCC AGG (reversed) Intronic
900618838 1:3577794-3577816 GGGAGGGGCCTGTCTTCCCCAGG - Intronic
900866002 1:5269123-5269145 GAGAGCATCCTGGATTCCCCAGG + Intergenic
901494628 1:9613980-9614002 CTGAGAACCCCATCTTCCCCTGG + Exonic
901647580 1:10724846-10724868 TTGAGCACCTTCTCTTCCCCAGG - Intronic
902979975 1:20115613-20115635 CTGTGCACCCTGTCTGCTCCAGG - Exonic
905298466 1:36969716-36969738 GTGAGTTCCGTGTCTTCCCTTGG - Intronic
910264121 1:85320797-85320819 CTGAGAAGCCTGTCTGCCCCTGG + Exonic
915634819 1:157178616-157178638 GTTCCCACCCTCTCTTCCCCAGG - Intergenic
915738338 1:158098770-158098792 CTGAGCACCCTGTCTTCAAGCGG + Intronic
916169538 1:161990891-161990913 GTGATCACACTGTCTTCACCAGG + Intronic
919731652 1:200916727-200916749 TTGCTCACCCTGTTTTCCCCGGG - Intergenic
924350233 1:243107664-243107686 ATCAGCCTCCTGTCTTCCCCTGG + Intergenic
1063474748 10:6318452-6318474 GTGAGCTCTCCTTCTTCCCCAGG + Intergenic
1063564657 10:7162329-7162351 GTGAGCACACTGTCTCCTGCTGG - Exonic
1065538624 10:26738875-26738897 GGGAGGACGCTGTCATCCCCTGG - Intronic
1066481426 10:35799103-35799125 AGGAGCACCCTGTCTTCCTACGG + Intergenic
1067440840 10:46308494-46308516 CTGAGCAGCCTGCCTTCCCACGG + Intronic
1068630918 10:59296767-59296789 GTGAGCATCTTCTCTTCCTCTGG + Intronic
1069921528 10:71818573-71818595 GTCACCAGCCTGTCTTGCCCTGG - Intronic
1070977977 10:80620558-80620580 GTAAGCAACCTGTCCTCCCCAGG - Intronic
1071459191 10:85876273-85876295 GTGAGAAACATGTCTCCCCCAGG - Intronic
1073561620 10:104502067-104502089 GTGTGCACCCTGTGATGCCCTGG + Intergenic
1075418325 10:122282089-122282111 GTGAGCACACTGCCTTCTCCTGG - Intronic
1076478405 10:130768136-130768158 GTGAGCAGCCTCTCCTGCCCTGG - Intergenic
1076733015 10:132447527-132447549 GTGATCAGCCTGGCTTCCCCAGG - Intronic
1076779711 10:132717412-132717434 GTGAGCAGCCTGGCTGCCCCAGG + Intronic
1077315711 11:1918524-1918546 ATGAGGTCCCTGTCCTCCCCAGG - Intergenic
1080502165 11:32881112-32881134 GGGATCTCCCTGTCTTGCCCAGG - Intergenic
1080859351 11:36139841-36139863 GGGGGCAACCTCTCTTCCCCTGG + Intronic
1083373263 11:62198764-62198786 GTGAGCACCTTGAAATCCCCAGG - Intergenic
1083580991 11:63825291-63825313 TGGAGCACGCTGGCTTCCCCAGG - Intronic
1084223337 11:67698441-67698463 GTTGGCTCCCTGTCTCCCCCAGG + Intergenic
1085351631 11:75801577-75801599 CTGGGGACCCAGTCTTCCCCAGG - Intergenic
1088841443 11:113630613-113630635 GGCAGAACCCTGCCTTCCCCAGG - Intergenic
1089070523 11:115696124-115696146 GTGGACACCCTGCCTCCCCCTGG - Intergenic
1089577097 11:119452706-119452728 GACAGCACCCTGTCATCCCTTGG + Intergenic
1091541170 12:1463953-1463975 CTTAGTACCCTGTCTTCCCCCGG - Intronic
1092119781 12:6035745-6035767 GCGAGGTCCCTGTCTTCCCTGGG + Intronic
1093144100 12:15543900-15543922 GTGAGAAGACTGTCTTTCCCAGG + Intronic
1093886903 12:24472211-24472233 GTGAGAACCCAGACTTCCTCTGG - Intergenic
1094625414 12:32119027-32119049 GTGATCAGGCAGTCTTCCCCAGG + Intronic
1097191432 12:57221344-57221366 GGGAGCACCCTGCCTGACCCAGG + Intronic
1101521797 12:105490550-105490572 GTGAGCACCTCCTCTGCCCCAGG + Intergenic
1102512167 12:113422944-113422966 CTGAGCCCCCTGCTTTCCCCTGG + Intronic
1102575377 12:113853064-113853086 GTGAGCCTACTGTCTTCACCTGG - Intronic
1103229204 12:119313928-119313950 CTGAACACCATGTCTTGCCCAGG - Intergenic
1104665265 12:130643213-130643235 GTGAGCTCCCTGCGTTCCACAGG - Intronic
1106109221 13:26761805-26761827 CTGACCAGCCTGCCTTCCCCTGG + Intergenic
1107152928 13:37132785-37132807 GGGAGCTCACTGTCTTACCCAGG + Intergenic
1108533289 13:51347099-51347121 GTGAGCACCATGTCCTTCCAAGG + Exonic
1109354978 13:61224107-61224129 ATCACCACCCTCTCTTCCCCTGG - Intergenic
1113375794 13:109764649-109764671 GGGAGGAGCCTGTCTTTCCCTGG - Intronic
1114688222 14:24555267-24555289 CTGGGCACCCAGTCTTCTCCAGG + Intergenic
1115728408 14:36241827-36241849 TTGAGCAAACTGTTTTCCCCAGG - Intergenic
1120052143 14:79879200-79879222 GGCAGCACCCTGTCTTCCCATGG + Intergenic
1121697567 14:95926254-95926276 GTCAGCACCTTGCCTGCCCCAGG + Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122522850 14:102358208-102358230 GTGTGCACAGTGTCTTTCCCAGG - Intronic
1124515334 15:30362738-30362760 GGGCGCACCTTGTCCTCCCCGGG + Exonic
1124727588 15:32167991-32168013 GGGCGCACCTTGTCCTCCCCGGG - Exonic
1125605933 15:40939953-40939975 CTGAGCACCTTGTCTGCCCAGGG + Intergenic
1126011810 15:44310309-44310331 GTGAGTACCCTTTCATCCCTTGG - Intronic
1127113132 15:55696076-55696098 GGGATCTCCCTGTGTTCCCCAGG - Intronic
1127630086 15:60820049-60820071 GTGTGCACGCGGTCCTCCCCTGG + Intronic
1128808984 15:70556205-70556227 GTGAGCACCCTGGGTGGCCCTGG - Intergenic
1129520917 15:76185930-76185952 GTGAGCCTCTTTTCTTCCCCGGG - Intronic
1130512938 15:84604136-84604158 GAGTGCACCCTGTGGTCCCCTGG - Exonic
1131200230 15:90389309-90389331 GTGCTCATACTGTCTTCCCCAGG - Intronic
1131509089 15:93039296-93039318 GAGACCACGATGTCTTCCCCAGG - Intronic
1132498637 16:275260-275282 GTGAGCGCCCTGCCTCCCACTGG - Intronic
1136370954 16:29835700-29835722 GTGACCAGCCATTCTTCCCCTGG - Exonic
1137523552 16:49213845-49213867 GTAATCCCACTGTCTTCCCCAGG + Intergenic
1141267470 16:82509874-82509896 GTGAGGACCCAGCCTTGCCCGGG - Intergenic
1141421724 16:83922028-83922050 GTGACCACAGTGTCTTCCTCTGG + Exonic
1142105404 16:88299772-88299794 CTGAGTCCCCTGTCTTGCCCAGG - Intergenic
1142643493 17:1298330-1298352 GTCAGCACCCTGGCCTCCCGCGG - Exonic
1142674857 17:1507401-1507423 TGGAGAACCCTGGCTTCCCCAGG - Intronic
1147266080 17:39235799-39235821 GTGAGCAAAGAGTCTTCCCCAGG + Intergenic
1147835171 17:43324833-43324855 GTGAGCCCTCTGTCATGCCCGGG - Intergenic
1148330538 17:46811454-46811476 GTGAGCACAGTGGCTACCCCAGG - Intronic
1148567950 17:48644899-48644921 GTGAGAACCCTGTCTGTCCTGGG + Intergenic
1149217100 17:54370240-54370262 GTGGGAAGGCTGTCTTCCCCTGG + Intergenic
1151507342 17:74538428-74538450 GAGGGCACCAGGTCTTCCCCTGG - Intergenic
1151597974 17:75089291-75089313 GTGACCCACCTGTGTTCCCCAGG - Exonic
1152134419 17:78495381-78495403 GAAAGCACTCTGTCTTCCCCTGG - Intronic
1153776070 18:8455248-8455270 GTGAGTGCTCTGTCTCCCCCAGG + Intergenic
1160147778 18:76378825-76378847 GTGCGGGCCCTCTCTTCCCCAGG - Intronic
1160811856 19:1016251-1016273 CTGCCCTCCCTGTCTTCCCCAGG - Intronic
1161331204 19:3688534-3688556 GTGAGCACCTGGCCTTTCCCTGG + Intronic
1162464195 19:10830760-10830782 GTGAGCCCCCTGCCCTCCCTGGG - Intronic
1163376824 19:16938271-16938293 GTGAGCACCTGCCCTTCCCCTGG - Intronic
1164412326 19:28016324-28016346 CTGAGTACTCTGTCTACCCCAGG + Intergenic
1166332709 19:42088139-42088161 GTGAGCCCCAGGTCTCCCCCTGG - Intronic
1167954711 19:53055446-53055468 GTGAGGAGCCTGCCTTTCCCTGG - Intergenic
925628709 2:5867326-5867348 GTGAGAACCCTGGCTGCCCCTGG + Intergenic
926125693 2:10270409-10270431 GAGAGCAGCCTGGCTTCGCCTGG + Intergenic
926624792 2:15082169-15082191 ATGAGTACCCTGTCATGCCCAGG + Intergenic
927275622 2:21259935-21259957 GCGAGCAGCCTGTTTTCACCAGG - Intergenic
930995571 2:57713214-57713236 ATGAACAGCCTGTCTTGCCCAGG - Intergenic
932306871 2:70710179-70710201 GTGAGCCCCCTGTGCTCCCTAGG + Intronic
935077365 2:99758033-99758055 GTGAGCACCCATTCTGCTCCAGG - Intronic
935816973 2:106855249-106855271 CTAAGCACCCTTTCTTCCCTGGG - Intronic
940155965 2:150657652-150657674 GTTGGCACCCTGTCTTACACAGG + Intergenic
942141921 2:172985551-172985573 GTTAGCAGCCTGGCTTCCCGTGG - Intronic
942586505 2:177484957-177484979 GGGATCTCCCTGTGTTCCCCAGG + Intronic
946509059 2:220334854-220334876 GTGAGCTCCCTGTTGGCCCCAGG + Intergenic
948508267 2:238445959-238445981 GTGCTCAGCCTGTGTTCCCCAGG + Intronic
1168771385 20:419178-419200 GTGGGCATCCTGGCTCCCCCAGG - Intronic
1171349425 20:24491321-24491343 TTGAGCATCCTGTCCTCTCCTGG - Intronic
1173617260 20:44411255-44411277 GTGATGAGCCTGTCTTCCCAGGG - Intronic
1174400403 20:50272907-50272929 GGGAACAGCCTGTCATCCCCAGG + Intergenic
1174783448 20:53411372-53411394 GTGAGCTCCATGTCTTGGCCTGG + Intronic
1175976574 20:62713316-62713338 TTGAGGCCCCTGTCTGCCCCTGG - Intronic
1176273334 20:64247816-64247838 GTGAGGACCCTGTATTAGCCAGG + Intergenic
1177426973 21:20935684-20935706 GGGATTACCCTGTGTTCCCCAGG + Intergenic
1179567103 21:42256073-42256095 GTGTGCACCCTTTCTTTCCAAGG + Intronic
1179766089 21:43574137-43574159 GCCAGCATCCTGCCTTCCCCTGG + Intronic
1182905806 22:33935330-33935352 GGGAACACCCTGTCTTCAACAGG + Intergenic
1183525157 22:38318219-38318241 GGAAGGACCCTGTCCTCCCCAGG + Intronic
1184249316 22:43251176-43251198 GTGGGCACCCACTCTTCCTCAGG - Intronic
1185018934 22:48362302-48362324 TTGGGCACCCTGTGCTCCCCAGG + Intergenic
1185323412 22:50213473-50213495 GAGAGCACACCGTCTTCTCCAGG - Intronic
1185323421 22:50213529-50213551 GAGAGCACACCGTCTTCTCCAGG - Intronic
949430977 3:3975561-3975583 GTTAGAACCCTGTGTTCCCATGG + Intronic
950731046 3:14958105-14958127 GAGAGCAATGTGTCTTCCCCTGG + Intronic
954068870 3:48128447-48128469 GTCAGCACCCTTTCTTGGCCTGG + Intergenic
960950436 3:122995411-122995433 GTGGCCACCCTGTCATCCCAGGG - Intronic
963281038 3:143384802-143384824 GTGTTCACCCTGGCTTCCCCAGG - Intronic
964292350 3:155195189-155195211 ATGTGCTCCGTGTCTTCCCCAGG - Intergenic
964599247 3:158477170-158477192 GTGTTCACACTGTCTTCACCAGG - Intronic
967288617 3:187897632-187897654 GAGAGCACCCTGCCCTCCACAGG - Intergenic
967752538 3:193130721-193130743 GTGAGCCCTCTGTCTGCCCGAGG + Intergenic
968426726 4:528555-528577 GTCAGCATCCTCTCTGCCCCAGG - Intronic
968912889 4:3484894-3484916 GTGACCACACTTCCTTCCCCCGG - Intronic
969423736 4:7111846-7111868 GTGGGCACCCTCTCTTTCCTGGG + Intergenic
969877670 4:10147936-10147958 GGGACCACCCAGTCTTCCCTAGG - Intergenic
970997799 4:22287794-22287816 GTGAGCTCCCTGACTCCCTCTGG - Intergenic
972354580 4:38268484-38268506 GTGTGCGGCCTGTCTGCCCCTGG + Intergenic
980643776 4:135615365-135615387 GTGAGGAACCTGTCTCCTCCAGG - Intergenic
981977548 4:150748897-150748919 TTGAGCACTGTGTCTTCACCTGG - Intronic
982447389 4:155508786-155508808 GTAAGCACCCTTTCTTACCGTGG + Intergenic
985099906 4:186448603-186448625 TTGAGCATCCTGTTTTTCCCAGG + Intronic
985445187 4:190017789-190017811 TTCAGCACCCTGTATTCCCAGGG - Intergenic
985842312 5:2317594-2317616 GTGGGCACTCTGGCTTCTCCTGG + Intergenic
986597638 5:9440054-9440076 GTGAGCACCCTGTCTTCCCCAGG - Intronic
988517406 5:31916799-31916821 GTAAGCCCCCTCCCTTCCCCAGG - Intronic
991471280 5:66971397-66971419 GTGAGAACACTGTCACCCCCAGG - Intronic
995029845 5:107467777-107467799 GTTACCACGCTGTCTTTCCCAGG + Intronic
995747085 5:115415449-115415471 GTGAGAACCCTTTCCTCCTCTGG + Intergenic
997836573 5:137199170-137199192 GGCAGCACCCTGTGTTCTCCTGG - Intronic
998558516 5:143149194-143149216 GTTATCACCCTCCCTTCCCCAGG - Intronic
1001309841 5:170602930-170602952 GTGAGCACACTCTCCTCCCCTGG + Intronic
1002088843 5:176792822-176792844 GAGGGGACCCTGTCATCCCCAGG - Intergenic
1002913589 6:1510417-1510439 GTGCATATCCTGTCTTCCCCAGG - Intergenic
1003119820 6:3310211-3310233 GGGAGCACCCTGTCTCCCACTGG + Intronic
1003119831 6:3310250-3310272 GGGAGCACCCTGTCTCCCACTGG + Intronic
1003829806 6:9995338-9995360 GTCACCACCCAGTCTTCCCATGG - Intronic
1006827610 6:36947684-36947706 GTGAGCACCATGTCCTGTCCAGG - Intergenic
1007352115 6:41281614-41281636 GTGTGCACCTTGTCTTCCTCAGG + Intronic
1008654306 6:53595955-53595977 GGCAGCTCCTTGTCTTCCCCTGG + Intronic
1010237645 6:73588648-73588670 GTGAGCCCCATGGCTTCCCTGGG - Intergenic
1011130488 6:84047061-84047083 CTCAGCACCCTGTCATCCTCTGG + Intronic
1012652273 6:101770310-101770332 GTCACCACCCTGTCTTACCTTGG + Intronic
1014241735 6:119025720-119025742 ATGAGCCCACTTTCTTCCCCCGG + Intronic
1017654179 6:156611506-156611528 GTGAGGACCCTGTCTTCATCAGG - Intergenic
1017889821 6:158628915-158628937 GTGAGCCTCCTGTCTCCCCCCGG + Intronic
1017950081 6:159129011-159129033 ATGAGCCCCCTGCCCTCCCCAGG + Intergenic
1019824199 7:3270037-3270059 TAGAGGACCCTATCTTCCCCAGG + Intergenic
1020945922 7:14606321-14606343 GTGATGAGCCTGTCTTCCACAGG + Intronic
1023217746 7:37882995-37883017 GTGAGGACCCTCTCTACACCTGG + Intronic
1023516659 7:41008478-41008500 GGGATCACCCTCTCTTTCCCCGG + Intergenic
1023889530 7:44382434-44382456 GTGACCACACTGTCCTCACCAGG + Exonic
1024055717 7:45658875-45658897 GTGAGCGCCCTGCCTGCCCCAGG + Intronic
1024061731 7:45703493-45703515 GTGAGCACCCAGCCTGCTCCTGG + Intronic
1028491538 7:91417844-91417866 ATGGGCACCATGTCTTCCCCTGG + Intergenic
1031083243 7:117278339-117278361 GTGTGCAACCTGACTTCCCGGGG - Exonic
1033145266 7:138865787-138865809 GGGAGGAACCTGTCTTCTCCTGG - Intronic
1033882707 7:145905642-145905664 TTGAGCAGGCTGTCTTCTCCTGG + Intergenic
1034646572 7:152652977-152652999 GTGAGCACCCTGTGGTCTCTGGG - Intronic
1034757026 7:153632059-153632081 GCGAGCCCTCTGTGTTCCCCGGG - Intergenic
1035596470 8:862135-862157 GTGAGCACCGTGTCATGGCCAGG + Intergenic
1035676295 8:1458700-1458722 GTGCAAACCCTGTCTTCCCCAGG - Intergenic
1036808024 8:11848373-11848395 GAGAGCCTCCTGTCTTCTCCCGG - Intronic
1038846047 8:31230455-31230477 GTGAGCCTCCTGCCTTCCCAAGG + Intergenic
1039517684 8:38147177-38147199 GTGATCTCCCTGTGTTGCCCAGG + Intronic
1043919308 8:85962859-85962881 GAGAGAACTCTGTCTTCCCTAGG + Intergenic
1044180509 8:89187892-89187914 ATGAACACCGTGTCTTCACCTGG - Intergenic
1044357338 8:91238325-91238347 ATGAGCTCCCTGCCTTCCACTGG + Intronic
1047705231 8:127492651-127492673 CTGAGCCCCATGTCTACCCCTGG - Intergenic
1047801323 8:128313647-128313669 GTGAGCTCCCTCTCTTTCCAGGG + Intergenic
1048304998 8:133278046-133278068 GTCAGCTCCTTGTGTTCCCCAGG - Intronic
1049724792 8:144140727-144140749 GTGTGGACCATGTTTTCCCCTGG + Exonic
1049798597 8:144507527-144507549 GTGAGGTCCATGTCTTCCCTGGG + Intergenic
1049941378 9:549600-549622 GGGAGCAGCCTGGCTTCCACCGG + Exonic
1050333592 9:4569835-4569857 CTGAGCACCCTCTATACCCCAGG + Intronic
1051871157 9:21739060-21739082 GTGAACACTCTGTCCTGCCCAGG - Intergenic
1056224276 9:84480242-84480264 GTGAGCACCTTCCCTTGCCCGGG + Intergenic
1057479021 9:95429531-95429553 GTGAAAACCCTGCCTTCCTCGGG - Intergenic
1058977501 9:110138170-110138192 CTGAGCGCCCTGTCTTCAGCAGG - Exonic
1060781163 9:126414381-126414403 GTGAGAGCCCTGTCTCCTCCGGG + Intronic
1061209796 9:129184444-129184466 GTGTGCAACCTCACTTCCCCAGG - Intergenic
1061721707 9:132556120-132556142 GTCAGCACCCTGGCCTCCACTGG + Intronic
1186519146 X:10189920-10189942 GTGATCATCCTGTTTGCCCCTGG + Intronic
1190024889 X:46913295-46913317 GTGGGCACCCGGGCTTCCCGGGG - Intronic
1190070187 X:47273156-47273178 GGGGGCACTCTGTCTTCACCTGG - Intergenic
1191255921 X:58279618-58279640 GTGAGGCCCCTGTCTTCCACTGG - Intergenic
1196245083 X:113391119-113391141 GAGACCACTCAGTCTTCCCCAGG - Intergenic