ID: 986598542

View in Genome Browser
Species Human (GRCh38)
Location 5:9448446-9448468
Sequence TGGGGTAGGCAGAAGGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 746
Summary {0: 1, 1: 1, 2: 2, 3: 40, 4: 702}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986598542_986598549 -10 Left 986598542 5:9448446-9448468 CCCCGCCCCTTCTGCCTACCCCA 0: 1
1: 1
2: 2
3: 40
4: 702
Right 986598549 5:9448459-9448481 GCCTACCCCAACAGTGGAATTGG 0: 1
1: 0
2: 2
3: 3
4: 76
986598542_986598551 -9 Left 986598542 5:9448446-9448468 CCCCGCCCCTTCTGCCTACCCCA 0: 1
1: 1
2: 2
3: 40
4: 702
Right 986598551 5:9448460-9448482 CCTACCCCAACAGTGGAATTGGG 0: 1
1: 0
2: 0
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986598542 Original CRISPR TGGGGTAGGCAGAAGGGGCG GGG (reversed) Intronic
900137605 1:1125011-1125033 TGGGGGAGGCAGGAGGGATGTGG + Intergenic
900392121 1:2438297-2438319 TGGGGTAAGAAGAAAGGGCAGGG + Intronic
900394282 1:2446757-2446779 TGGGGCTGGCAGAGGGGTCGGGG + Intronic
900428566 1:2591672-2591694 TGGGGTGGCCAGGAGGGGTGGGG + Intronic
900475456 1:2874357-2874379 TGGAGTAGGAAGGAGGGGCCAGG + Intergenic
900858550 1:5206225-5206247 TGGGGCATGGGGAAGGGGCGGGG - Intergenic
901506974 1:9690845-9690867 TGGGGTTGGGAGAAGGGGTTGGG + Intronic
901679812 1:10906418-10906440 TGGGGTGGGAGGAAGGGGCCTGG + Intergenic
902406652 1:16187798-16187820 AGGGGTAGGGAGTAGGGGCAGGG - Intergenic
902530582 1:17088136-17088158 TGGGGAGGGCAGAAGAGGCACGG + Intronic
902625178 1:17672193-17672215 TGGGGAAGGCGGCTGGGGCGGGG - Intronic
902701964 1:18178746-18178768 TGGGGTAGGGGGAAGGGGAAGGG - Intronic
902748059 1:18486423-18486445 TGGGGTAGGAAGAAGGACAGGGG + Intergenic
903222055 1:21874586-21874608 TGGGGTGGGCGGAAGGAGGGCGG + Intronic
903225619 1:21892925-21892947 TGGTGCAGCCAGCAGGGGCGAGG + Intronic
903413854 1:23168351-23168373 TGGGGTTGGGGGAGGGGGCGCGG - Intronic
903675304 1:25060894-25060916 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
903773378 1:25778064-25778086 TTGGGCAGGGAGAAGGGGCGTGG - Intronic
904041233 1:27586346-27586368 TGAGACAGGCAGAAGGGGAGAGG + Intronic
904499387 1:30905407-30905429 TTGGGAAGGCAGGAGGGGTGGGG - Intronic
904769414 1:32872527-32872549 TGGGGCAGGCAGCAGCTGCGGGG - Intergenic
905167114 1:36089151-36089173 GGAGGGAGGCCGAAGGGGCGCGG + Intronic
905442893 1:38005861-38005883 TGGGGTAAGGTGAAGGGGTGGGG - Intergenic
905558707 1:38908948-38908970 TGGGGTAGCCAGAAGGCGGATGG + Intronic
905636820 1:39559557-39559579 GGGGGTGGGCAGAGTGGGCGGGG - Intergenic
905842281 1:41192131-41192153 TGGATTAGGCAGAATGGGCAGGG - Intronic
906033343 1:42736684-42736706 TGGAGTCGGCGCAAGGGGCGGGG - Intronic
906589973 1:47015790-47015812 TGGATGAGCCAGAAGGGGCGAGG - Intergenic
907190646 1:52645069-52645091 TCGGGGAGGTAGAAGGGGCAAGG + Intronic
907236799 1:53056824-53056846 TTGGGGAGGCAGAAGGTGGGAGG - Intergenic
907335310 1:53695641-53695663 TCAGGAAGGCAGGAGGGGCGCGG + Intronic
907664053 1:56418589-56418611 TGGGGGTGGCAGTGGGGGCGCGG - Intergenic
907795384 1:57710921-57710943 TGGGGCAGGCAGGAGGGTCAGGG + Intronic
908140442 1:61179036-61179058 TGGGGCAGGCTGAAAGGGCAGGG - Intronic
909559434 1:76993099-76993121 TGGGGAAGGCAAAAGGGGCATGG - Intronic
909761910 1:79299445-79299467 GGGGGCAGGCAGAAGTGGAGTGG - Intergenic
910769576 1:90817411-90817433 TGAGGTAGGCAAAAGGGTCTTGG - Intergenic
911146508 1:94557586-94557608 TTGGGGAGGAAGAAGGGGAGAGG - Intergenic
911728984 1:101272192-101272214 TGGGGTAGGGGGGAGGGGGGAGG - Intergenic
912135223 1:106652898-106652920 TGGGGTAGGGAGATGGGGGAGGG - Intergenic
912640547 1:111341207-111341229 TGGGGTGGGGGGAAGGGGGGAGG + Intergenic
913084097 1:115419056-115419078 TGGGGTGGGGAGAGGGGGGGAGG + Intergenic
913129758 1:115828784-115828806 TGGGGGAGGCGGGACGGGCGCGG - Intergenic
913283005 1:117203241-117203263 TGGGGTGGGGAGAAGGGATGGGG + Intronic
913578386 1:120200329-120200351 TGGGGTAGGGAGGTGGGGCTGGG + Intergenic
913629786 1:120698022-120698044 TGGGGTAGGGAGGTGGGGCTGGG - Intergenic
914049041 1:144116126-144116148 TAGAGTAGGAAGCAGGGGCGGGG - Intergenic
914130143 1:144849319-144849341 TAGAGTAGGAAGCAGGGGCGGGG + Intergenic
914560309 1:148811769-148811791 TGGGGTAGGGAGGTGGGGCTGGG + Intronic
914612524 1:149318446-149318468 TGGGGTAGGGAGGTGGGGCTGGG - Intergenic
914811949 1:151035455-151035477 TGGGGTAGGAAAAAGGGGAAAGG - Exonic
915213283 1:154325461-154325483 TGGGGAGGGGAGAAGGAGCGGGG - Intergenic
915257050 1:154641535-154641557 GGAGGTAGGCAGGAGGGGCAAGG - Intergenic
915912230 1:159922440-159922462 TGGGGAAGGCAGGCGGGGTGGGG + Intronic
916240230 1:162632111-162632133 TGGGGTAGGCGGCGGGGGGGTGG + Intronic
917254863 1:173103599-173103621 TGGGGAAGTCAGAAGGGGGATGG + Intergenic
918332340 1:183472365-183472387 AGGGGGAGGGAGGAGGGGCGGGG - Intronic
918817513 1:189208593-189208615 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
918874815 1:190027062-190027084 TGGGGTGGGCAGAGGGGGGAGGG - Intergenic
919453662 1:197799581-197799603 TGGGGTAGGGACAAAGGGCCTGG - Intergenic
919830219 1:201535614-201535636 TGGGGTGGGGAGGTGGGGCGGGG + Intergenic
922199859 1:223393019-223393041 AGGGGTGGGGAGAAGGGCCGGGG - Intergenic
922442003 1:225663735-225663757 TGGGGTAGGAGGAATGGGTGAGG + Intergenic
923033468 1:230267761-230267783 TGGGGTGGGCAGAGGCGGAGGGG + Intronic
1065135093 10:22659814-22659836 TGGGGGTGGGAGGAGGGGCGCGG - Intronic
1067175260 10:43941504-43941526 TGGGGCAGGCAGCAGGGCTGGGG - Intergenic
1067947872 10:50702114-50702136 TGGAGTAGGCAGGATGGGTGGGG - Intergenic
1068268991 10:54695059-54695081 TGGGGTAGGGGGAGGGGGAGGGG + Intronic
1068928469 10:62564506-62564528 TGGGGTAGGGAGAGGGGGAGGGG - Intronic
1069255746 10:66330210-66330232 TGGGGTGGGGAGAGGGGGGGAGG - Intronic
1069895582 10:71678462-71678484 TGGGGTAGGCAGCATGGGGAAGG - Intronic
1070058034 10:72954101-72954123 TGGGGTGGGAAGAAGGAGGGTGG - Intronic
1070634806 10:78116718-78116740 AGGAGCAGGCAGAAGGGGAGGGG + Intergenic
1070810973 10:79297991-79298013 TGGGGTAGGCATAGAGGGTGTGG + Intronic
1070883186 10:79867111-79867133 TGGAGTAGGCAGGATGGGTGGGG - Intergenic
1071164163 10:82785204-82785226 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1071573260 10:86709499-86709521 AAGGGTAGGCAGAAGAGGCCAGG + Intronic
1071649754 10:87383418-87383440 TGGAGTAGGCAGGATGGGTGGGG - Intergenic
1071917469 10:90310699-90310721 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
1072565862 10:96616094-96616116 AGGGGTAGGCTTAAGGGGAGCGG + Intronic
1072591649 10:96832797-96832819 TGGGGGAGGCGCGAGGGGCGCGG + Intronic
1072905646 10:99450924-99450946 CGGGGGAGGCAGGAGGAGCGGGG - Intergenic
1073077995 10:100836523-100836545 GGGGGTGGGCAGCAGGGGAGGGG + Intergenic
1073175506 10:101554052-101554074 GGGGGCAGGCAGAGGGGGTGGGG + Exonic
1074772183 10:116741807-116741829 TGGGGAAGGGTGAAGCGGCGGGG - Intronic
1075129949 10:119729134-119729156 TGGGGGAGGGGGAAAGGGCGGGG + Intronic
1076064454 10:127438354-127438376 TGGGGTAGGCAGAAGGGTGGTGG + Intronic
1076347986 10:129793815-129793837 TGAGGTGGGGAGAAGGGGAGAGG - Intergenic
1076676536 10:132149924-132149946 CGGGGTGGGCAGAGGGGGTGGGG - Intronic
1076833821 10:133010054-133010076 TGGGGTGGGCTGCAGGGGCAAGG - Intergenic
1076885533 10:133260764-133260786 TGGGGATGGGAGAAGGGGCTCGG + Intergenic
1077140984 11:1024771-1024793 TGGGGGCGGGGGAAGGGGCGGGG - Intronic
1077159133 11:1104669-1104691 TGGGGTAGAGAGCAGGGGAGAGG + Intergenic
1077161202 11:1113463-1113485 CTGAGTGGGCAGAAGGGGCGGGG - Intergenic
1077301813 11:1850879-1850901 TTGGGTAGGCAGAGGGGAGGAGG + Intergenic
1077330264 11:1981049-1981071 TGGGGCAGGCAGAGGGGGTGTGG + Intronic
1077819420 11:5721941-5721963 TGGGGTGGGGGGAAGGGGGGAGG - Intronic
1078052068 11:7974379-7974401 TGGGGTGGGGGGAAGGGGAGAGG + Intronic
1078250884 11:9615364-9615386 TGTGGTTGGCAGAAGGGTCCTGG - Intergenic
1078413824 11:11149103-11149125 TGGGATGGGAAGAAGGAGCGGGG + Intergenic
1079857007 11:25617465-25617487 TGGGGTAGGGGGGAGGGGAGAGG + Intergenic
1080304365 11:30820542-30820564 TGGAGTAGGAAGATGGGGCTGGG + Intergenic
1080374568 11:31693300-31693322 TGGGGTTGGGGGAAGGGGGGAGG - Intronic
1080828182 11:35865780-35865802 TGGGGTAGGATGGAGGGGCTAGG - Intergenic
1080985652 11:37461237-37461259 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
1081637359 11:44729396-44729418 GGGGGTAGGGAGAAGAGGGGAGG - Intronic
1081863117 11:46345486-46345508 TGGGGACGGAAGAAGGGGAGCGG + Intronic
1081870767 11:46381629-46381651 GGGGGTGGGGAGAGGGGGCGGGG + Intronic
1081981649 11:47270360-47270382 TGGGGGAGTGTGAAGGGGCGTGG + Intronic
1082596708 11:55090370-55090392 TGGGGTGGGGGGAAGGGGGGAGG + Intergenic
1083095024 11:60241862-60241884 CGGGGTGGGGAGGAGGGGCGGGG - Intronic
1083129117 11:60606746-60606768 TGGTGTAGAGAGAAGGGGCTAGG + Intergenic
1083542942 11:63527171-63527193 TGGGGTGGGGAGAAGGGGGGAGG + Intergenic
1083879284 11:65540202-65540224 TGGGGTACGCGGGAGGGGCGGGG - Intronic
1083880020 11:65543775-65543797 TGGGGCAGGGAGAGAGGGCGGGG - Intronic
1083892020 11:65600184-65600206 GTGGGTGGGCAGAAGGGGCAGGG - Intronic
1084023939 11:66436225-66436247 TCAGGGAGGCAGAAGGGGCCAGG - Intronic
1084181074 11:67446303-67446325 TGTGGTAGGCAGGAGGTGTGTGG + Intergenic
1084298132 11:68226339-68226361 TGCGTTAGGCAGGAGGGGCAAGG + Intergenic
1084557860 11:69885629-69885651 TGGGGAAGGCAGAATGGGGAGGG + Intergenic
1084557879 11:69885685-69885707 TGGGGAAGGCAGAATGGGGAGGG + Intergenic
1085537895 11:77236324-77236346 TGGGGTGGGGAGACGGGGCAGGG - Intronic
1085772791 11:79339907-79339929 TGGGGTAGGCAGACCAGGCATGG + Intronic
1086046087 11:82533772-82533794 TGGGGGAGGAAGGTGGGGCGGGG - Intergenic
1087794887 11:102445019-102445041 TGGGGTGGGGGGAAGGGGGGAGG + Intronic
1088155751 11:106800738-106800760 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1088537952 11:110882070-110882092 TGGGGTAGGGAGAGGGGGGAGGG + Intergenic
1088930063 11:114342265-114342287 TGGGGTGGGGGGAAGGGGGGAGG + Intergenic
1089126679 11:116181197-116181219 TGAGGAGGGAAGAAGGGGCGGGG - Intergenic
1089563296 11:119356803-119356825 CGGGGAAGGGAGAAGGGACGTGG + Exonic
1202813243 11_KI270721v1_random:36228-36250 TGGGGCAGGCAGAGGGGGTGTGG + Intergenic
1091817218 12:3447636-3447658 TGTGGTAGGGAGAAGCGGGGTGG - Intronic
1091916671 12:4275060-4275082 TGGGGTAGGAAGGGGGGGAGGGG + Intronic
1092126916 12:6080957-6080979 TGGGGTGGGCAGCAGGAGCCAGG + Intronic
1092730564 12:11529647-11529669 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
1093160595 12:15741854-15741876 TAGGGTTGGGGGAAGGGGCGAGG - Intronic
1094249288 12:28340964-28340986 TGGGGTAGCCAGAAGGGAGATGG + Intronic
1094259726 12:28479464-28479486 TGGGGTAGGGGGAAGGGGGAAGG + Intronic
1096079472 12:48824115-48824137 GGCGGTGGGCAGAAGGGGCCAGG - Intronic
1096229534 12:49889411-49889433 AGGGGAAGGCAGATGGGGTGGGG - Intronic
1096229876 12:49890875-49890897 TGAGGTAGGGAGAAGGGGAATGG - Intronic
1097944252 12:65349049-65349071 TGGGGTGGGGAGAAGGGGGAGGG - Intronic
1099961009 12:89396941-89396963 TCGGGTAGGCAAAGGGGGCTAGG + Intergenic
1100209689 12:92388258-92388280 TGGGGTGGGCAGTGGGGGTGTGG + Intergenic
1100593085 12:96047464-96047486 TGGGGTAGGGAGAAGGGTGTTGG - Intergenic
1101190211 12:102325090-102325112 TGGGGTAGGGGGAAGGGGGGAGG - Intergenic
1101714642 12:107300213-107300235 TGGGGTAGGGAGAGGGGGAAGGG - Intergenic
1101915560 12:108893063-108893085 TGGGGCAGGGAGAAGAGGGGAGG + Intronic
1102027240 12:109720445-109720467 TGGGGGAGGCAGAGGTGGCAGGG + Intronic
1102236731 12:111298467-111298489 TGGGGGTGTCAGGAGGGGCGGGG + Intronic
1103058624 12:117841265-117841287 GGGGGAAGGCAGAAAGGGCAAGG - Intronic
1103347829 12:120263272-120263294 TGGGGTGTGCAGGAGGGGAGAGG - Intronic
1104519207 12:129457440-129457462 TGGGGTAGGGGGGAGGGGAGAGG + Intronic
1104813574 12:131633335-131633357 TGGGGGAGGCAGAAGGTGCCTGG + Intergenic
1105068468 12:133219330-133219352 CGGGGAAGGCAGATGGGGCTGGG + Exonic
1107379943 13:39845819-39845841 TGGGATAAGAAGAAGGGGAGAGG - Intergenic
1107414918 13:40191578-40191600 GGGGGTTGGAAGAAGGGGAGGGG - Intergenic
1107686199 13:42901908-42901930 TGGGGTGGGGGGAAGGGGGGAGG - Intronic
1107688401 13:42927285-42927307 AAGGGTAGGCAGAATGGGCCAGG - Intronic
1107785205 13:43948755-43948777 TGGGGGATGGAGAAGGGGAGAGG + Intergenic
1107804581 13:44142031-44142053 TGGGGGAGGCGGAGCGGGCGGGG - Intergenic
1108065970 13:46577933-46577955 TGGGGGATGCAGAAGGGCAGTGG + Intronic
1108169808 13:47729560-47729582 TGGGGTGGGCAGAGGGGGGAGGG - Intergenic
1108622272 13:52195724-52195746 TCGGGAAGGCAGAAGCCGCGAGG + Intergenic
1108760929 13:53563702-53563724 TGGGGTGGGGGGAAGGGGGGAGG - Intergenic
1108837037 13:54563379-54563401 GGGGGTAAGCAGGAGGGGTGGGG + Intergenic
1109003807 13:56842690-56842712 TGGGGTGGGGGGAAGGGGGGAGG - Intergenic
1110157652 13:72337988-72338010 TGGGGTAGGGAGAGGGGGGAGGG - Intergenic
1110964515 13:81676151-81676173 TGGGGAAGCCAGAAGGGGGATGG + Intergenic
1111097640 13:83535587-83535609 TGGGGGAGGCAGAAGGGAGATGG - Intergenic
1111605183 13:90529186-90529208 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1112368262 13:98773842-98773864 AGGGGCAGGCTCAAGGGGCGAGG - Intergenic
1113278109 13:108757620-108757642 TGGGGTGGGGAGAAGGGGGAGGG - Intronic
1113708897 13:112451654-112451676 TGGCGGAGGCAGAAGGTGGGAGG + Intergenic
1114438295 14:22726283-22726305 TGGGGAAGACAGCAGGGGCATGG + Intergenic
1114440486 14:22742724-22742746 TGGGATAGGCAGGAAGGGCAGGG - Intergenic
1114595213 14:23906264-23906286 TGGGATAGGCAGAAGGAGATAGG - Intergenic
1114631397 14:24161645-24161667 TGGGGCAGGAAGTAGGGGTGGGG - Intronic
1114694381 14:24612836-24612858 TGGAGTGGGCAGATGGGGAGGGG - Intergenic
1114800589 14:25771459-25771481 TGGGGTGGGGGGAAGGGGGGAGG - Intergenic
1115281588 14:31668835-31668857 GAGGGTAGGCAGAAGCAGCGTGG - Intronic
1116281173 14:42910188-42910210 TGGGGTAGGGGGAGGGGGAGGGG - Intergenic
1116515009 14:45794751-45794773 TGGGGTGGGGAGAAGGGGGATGG - Intergenic
1116604326 14:46969784-46969806 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1117227702 14:53680208-53680230 TGGGGTAGGGGGAGGGGGCAGGG - Intergenic
1118806806 14:69245046-69245068 TGGGACAGGCAGAAGGTGCTGGG - Intergenic
1119407045 14:74405479-74405501 AGGAGCAGGCAGCAGGGGCGTGG + Intergenic
1120778997 14:88468960-88468982 TGGGGTAGGAAGGACTGGCGTGG - Exonic
1120976582 14:90254224-90254246 TAGGGTGGACAGAGGGGGCGGGG - Intergenic
1121310653 14:92933476-92933498 TGGGGAAGACAAATGGGGCGTGG + Intronic
1122159694 14:99774103-99774125 TGGGGTGGGCAGAAAGAGCCTGG + Intronic
1122248233 14:100419286-100419308 AGAGGTAGGCGGAAGGAGCGAGG - Intronic
1122346153 14:101061816-101061838 TGGAGCAGGCAGTGGGGGCGAGG - Intergenic
1122634206 14:103122717-103122739 CGGAGCAGGCAGAAGGGGAGGGG - Intergenic
1122856149 14:104561129-104561151 TGGGGCAGGCAGCTGGGGCAGGG - Intronic
1122961930 14:105097882-105097904 TGGGGAGGGCAGAGGGGGCCAGG + Intergenic
1124668714 15:31617919-31617941 TGGGGTGGGCGGAGGGGGCAGGG - Intronic
1124816773 15:33001683-33001705 AGGGGGAGGCGGAAGGGGAGGGG - Intronic
1125290069 15:38136810-38136832 TGGGGTGGGGAGAGGGGGCAGGG - Intergenic
1125482155 15:40088481-40088503 TGGGGTAGGCAGAAGGGACGTGG - Exonic
1125632055 15:41155104-41155126 TGGGGGAGACAGGTGGGGCGTGG - Intergenic
1125714243 15:41810235-41810257 TGGGGTATGCACAAGGGCTGCGG + Intronic
1125890092 15:43259176-43259198 TGGTGTGGGCAGAAGGGGTCAGG - Intronic
1126693127 15:51303174-51303196 TGGGGTGGGCAGATGTGGAGGGG + Intronic
1127224863 15:56918545-56918567 TGGGGCCGGCAGAGGGGGCGGGG - Intronic
1127531536 15:59847937-59847959 AGAGGTAGGAAGAAGGGGAGAGG + Intergenic
1127688982 15:61376088-61376110 TGGTGTAGGCAGAAGCAGGGTGG + Intergenic
1128086711 15:64891703-64891725 TGGGATGGGTAGAAGGGGCAGGG + Intronic
1128702678 15:69815637-69815659 TGATGGAGGCAGAAGGGGCCTGG + Intergenic
1129598190 15:76981286-76981308 TTGGGGAGGCAGTGGGGGCGGGG - Intergenic
1129753150 15:78080021-78080043 TGGGGTAGGCAGTCAGGGTGAGG + Intronic
1130108252 15:80945050-80945072 TGGGGTAGGAAGCATGGGCCAGG - Intronic
1130648999 15:85751572-85751594 TGGGGATGGCGGAAGGGGCAGGG - Intergenic
1130673177 15:85930742-85930764 TGGGGTAGAGAGAAGGGAGGAGG - Intergenic
1130859751 15:87875545-87875567 TGGGGTAGGGGGAAGGGCTGAGG - Intronic
1131145420 15:90008233-90008255 TGGGGTAGGCACTAGGGATGGGG - Intronic
1131169944 15:90170743-90170765 TGGGGTAGGAGAAAGGGACGTGG + Intronic
1131342220 15:91613108-91613130 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1131431245 15:92390967-92390989 AGGGGTAAGCAGGAGGGGAGGGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132481791 16:169952-169974 TGGGGAAGGAGGAAGGGGCTGGG + Intergenic
1132482659 16:174209-174231 TGGGGAAGGAGGAAGGGGCTGGG + Intergenic
1132602464 16:779786-779808 TGGGGTGGGCAGAGGCGGCAGGG + Intronic
1132638097 16:963204-963226 TGGTGGAGGCAGTAGGGGTGTGG - Intronic
1132678587 16:1130694-1130716 TGGGGACGGCAGAGGGGGCCCGG + Intergenic
1132926028 16:2429531-2429553 CAGGGCAGGCAGAAGGGGTGTGG - Intronic
1132932722 16:2467216-2467238 TGGGGTTGCCGGGAGGGGCGAGG - Intergenic
1133214526 16:4283547-4283569 AAGGGTAGGAAGAAGGGGCCAGG - Intergenic
1133558112 16:6924828-6924850 TGGGGTAGGGGGAGGGGGAGGGG - Intronic
1134149035 16:11791233-11791255 TGGGGGAGGCAGGAGCTGCGTGG - Intronic
1134989490 16:18686493-18686515 TGGTGTCAGCAGAAGGGGTGAGG - Intergenic
1135087323 16:19485936-19485958 TGGGGGAGGAAGAAGGAGAGGGG + Intronic
1135345511 16:21685470-21685492 TGGAGGAGGCAGAAGGAGAGAGG - Intronic
1135381188 16:21997427-21997449 AGGGGGAGGCAGGAGGAGCGAGG + Intronic
1136287910 16:29254857-29254879 CGAGGGAGGGAGAAGGGGCGGGG - Intergenic
1136544409 16:30947594-30947616 TGGGGGAGGTGGAAGGGGCGGGG + Exonic
1136605406 16:31330284-31330306 TGGGGAACGCAGGAGGGGAGGGG - Intronic
1136608247 16:31350970-31350992 TGGGGTCTCCAGAAGGGGAGAGG + Intergenic
1137460912 16:48662489-48662511 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1137625483 16:49905371-49905393 TGTGGGAGGCAGAGGGGGAGAGG - Intergenic
1137990954 16:53154540-53154562 TGGGGTAGGGAAATGGGGTGTGG + Intronic
1138128333 16:54456984-54457006 TGGGGGAGCCAGAAGGGAGGTGG + Intergenic
1138531661 16:57637780-57637802 TGGGAAAGGCAGCAGGGGCTTGG - Intronic
1138891913 16:61154038-61154060 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1139249152 16:65478158-65478180 TGGGGTAGGAGGAAGGGCCCAGG - Intergenic
1139338223 16:66248496-66248518 TGGAGGCGGCAGAAGGGGCTGGG - Intergenic
1140974283 16:80044283-80044305 TGGGGAAGGGAAAAGGGGTGGGG + Intergenic
1141579685 16:84988733-84988755 TGGGGTAGGCACATGGGGGAGGG - Intronic
1141601197 16:85127263-85127285 TGGGGTAGGGAGCGGGGGAGGGG + Intergenic
1141617946 16:85220926-85220948 GGGGGTGGGCAGGAGGGGTGGGG - Intergenic
1141957030 16:87379375-87379397 TGGGGTAGGTACAAGGAGTGTGG + Intronic
1142008474 16:87701595-87701617 TGGGGTCGGCAGAGTGGGCCAGG + Intronic
1142160655 16:88555767-88555789 GGGGGTGGGCAGAGGGGGTGGGG - Intergenic
1142369665 16:89671547-89671569 TGGGGTAGGGGGGAGGGGGGAGG - Intergenic
1143465534 17:7133956-7133978 TGGGGTGGCCAGAAGGGGGATGG + Intergenic
1143571316 17:7760391-7760413 TGGGGAAGGGAGCAGGGGCTTGG + Intronic
1143576468 17:7796669-7796691 TGGGCCAAGCAGAAGGGGCAAGG - Intronic
1144969146 17:19096212-19096234 AGTGGGAGGCAGAAGCGGCGGGG + Intronic
1144978770 17:19155854-19155876 AGTGGGAGGCAGAAGCGGCGGGG - Intronic
1144989452 17:19222378-19222400 AGTGGGAGGCAGAAGCGGCGGGG + Intronic
1145685922 17:26663993-26664015 TGGGGTGGGGGGAAGGGGGGAGG - Intergenic
1145938000 17:28726315-28726337 GGGGGCAGGCGGACGGGGCGGGG - Intronic
1145988263 17:29062037-29062059 TGGGTTAGGGAGAATGGGGGAGG + Intergenic
1146257584 17:31400539-31400561 TCGGAGAGGCAGAAGGGGCCGGG + Intronic
1146285487 17:31571652-31571674 TGGGGTGGACAGAAGGAGGGCGG + Intronic
1147191372 17:38739981-38740003 TGGGCTTGGCAGCAGGGGGGTGG - Intronic
1147192056 17:38743766-38743788 TGGGGTGGGGAGATGGGGAGAGG - Intronic
1147420390 17:40319532-40319554 TGGGGTAAGCAGCAGGGGGTGGG - Intronic
1147968701 17:44207913-44207935 TGGGGGAGACAGAAGCGGCAAGG + Intronic
1148084506 17:44985807-44985829 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1148355332 17:46971986-46972008 TGGGGTAGGCAGAGGGCACAGGG + Intronic
1149431464 17:56597676-56597698 AGGGGTGGGGAGGAGGGGCGCGG - Intergenic
1149499605 17:57142174-57142196 TGGGGTGGGGAGATGGGGGGAGG - Intergenic
1149620345 17:58040089-58040111 TGGGGCAGGGAGAAGGGACCTGG + Intergenic
1149946708 17:60935999-60936021 TGGGGTGGGGGGAAGGGGGGAGG - Intronic
1150289655 17:63973928-63973950 AGGGCTGGGCAGAAGGGGAGAGG - Intergenic
1151450120 17:74193678-74193700 TGGGGAGGGCAGAGGAGGCGTGG - Intergenic
1151461297 17:74255793-74255815 TGGGGTGGGCAGAAGGGTCCTGG + Intronic
1151496986 17:74463779-74463801 TGGGGTGAGCAGGATGGGCGTGG + Intergenic
1151671609 17:75574281-75574303 TGGGGCTGGCAGGAGGGGTGGGG + Intronic
1151715802 17:75830484-75830506 TGGGGTGGGGAGCAGGGGCAGGG + Intronic
1151958483 17:77392627-77392649 TTGGGAAGGCAGAGGGGGAGGGG + Intronic
1152119973 17:78412614-78412636 TGGGGAAGGCTGGAGGTGCGTGG - Intronic
1152580876 17:81165221-81165243 TGGGATAGGCAGAGGGGGCTGGG - Intronic
1152641352 17:81450574-81450596 TGGGGCAGGCAGGAGGGCCATGG - Intronic
1152744641 17:82033107-82033129 TGGGGTAGGCACACGGAGTGGGG + Intronic
1152795331 17:82303655-82303677 TGGGGTAGGCAGGCTGAGCGTGG + Intergenic
1152913067 17:83016579-83016601 TGGAGGAGGGAGAAGGGGAGAGG + Intronic
1154006156 18:10528761-10528783 TGGGGCAGGGAGGTGGGGCGGGG + Intronic
1154357616 18:13633684-13633706 TGGAGCAGGCAGCAGGAGCGGGG + Intronic
1154472680 18:14720377-14720399 TGGGGTAGGAAGTAGGGGGTAGG + Intergenic
1155453494 18:25987179-25987201 TGGGGCAGGAAGAAGGGGGTTGG - Intergenic
1155498368 18:26464344-26464366 TGAGGGAGGCAGGAGGGCCGGGG - Intronic
1155592043 18:27438513-27438535 TGGAGGAGGCAGAAGGTGGGAGG + Intergenic
1159237970 18:65702160-65702182 TGGGGTGGGCGGAGGGGGCAGGG - Intergenic
1159800583 18:72894629-72894651 TGGGGTGGGCAGAGGGGGGAGGG + Intergenic
1160250608 18:77200615-77200637 TGGGGTAGGCAGTAGAGTTGGGG - Intergenic
1160513568 18:79466077-79466099 TGGGGTGGGGAGCAGGGGTGCGG + Intronic
1160691940 19:464218-464240 TGGTGTAGGCATTAGGGGCAGGG + Exonic
1160692032 19:464588-464610 TGGGGAAGGCAGCAGGGAGGAGG - Intronic
1160722778 19:604670-604692 GGGGTCAGGCAGCAGGGGCGGGG + Intronic
1160731293 19:642779-642801 TGTGGGAGTCAGAAGGGGCAGGG - Intronic
1160787409 19:907437-907459 CGGGGAAGTCAGAGGGGGCGGGG + Intronic
1161079662 19:2304346-2304368 TGGGGTTGGCAGAATGGGGTTGG + Intronic
1161203560 19:3028967-3028989 TGGGGGAGGCTGAAGTGGGGTGG + Exonic
1161250203 19:3276138-3276160 TGGGTGAGGCTGCAGGGGCGGGG + Intronic
1161267263 19:3370058-3370080 TGGGGGAGGCAGCAGGGCCCAGG + Intronic
1161431187 19:4233313-4233335 TGGGGGCGGCAGTGGGGGCGGGG + Intronic
1162246711 19:9407242-9407264 CGGGAAAGGCAGAAGGGGCGGGG + Intergenic
1162497087 19:11029330-11029352 TGGAGTAGGCAGAAGGGCACTGG - Intronic
1162683054 19:12361671-12361693 AGGGGGAGGCAGAGGGGGAGGGG - Intronic
1163004534 19:14389206-14389228 AGGGGGAGGGAGAAGGGGAGGGG + Intronic
1163096564 19:15062196-15062218 TGGAGCAGGCAGAAGGGAGGTGG + Intergenic
1163647515 19:18498207-18498229 TGGGGGAGGCTGCAGGTGCGGGG + Intronic
1163849250 19:19654225-19654247 TGGGGGAGGCAGGAGGGAGGTGG - Intronic
1164590736 19:29505403-29505425 TGGGGTGGGCAGGTGGGGCCAGG + Intergenic
1164680551 19:30131188-30131210 AGGGGAAGGGAGAAGGGGAGGGG - Intergenic
1165313395 19:35041371-35041393 TGGAGGACGCAGAAAGGGCGGGG + Intronic
1166215312 19:41330982-41331004 TGGGCAAGGCAGCGGGGGCGGGG + Exonic
1166354278 19:42217723-42217745 TGGGGGAAGGAGGAGGGGCGAGG - Intronic
1166367940 19:42286662-42286684 GGGGGTAGACAAAAGGGGTGGGG + Intronic
1166589218 19:43981784-43981806 AGGGGTAGGAAGGAGGGGAGTGG + Intronic
1167050054 19:47072504-47072526 TGGGGGAGGGGGAGGGGGCGGGG + Exonic
1167333141 19:48868679-48868701 TGGGGAGGCCAGAAGGGGCGGGG - Intergenic
1167441798 19:49513133-49513155 TGAGGGGGGCGGAAGGGGCGTGG + Intronic
1167672021 19:50858993-50859015 TCGGGGAGGGAGAAGGGGTGGGG + Intronic
1167674767 19:50877406-50877428 TGGGGCAGGGAGGAGGGGTGGGG + Intronic
1168017054 19:53582034-53582056 TGGGGTAAGGAGAAGGGCAGGGG + Intergenic
1168329318 19:55557537-55557559 TGGGGGAGGCAGTGGGGGCAGGG - Intergenic
1168600356 19:57713082-57713104 AGAGGTAGGCAGGAGGGGCCAGG + Intronic
1202688492 1_KI270712v1_random:69020-69042 TAGAGTAGGAAGCAGGGGCGGGG - Intergenic
925301319 2:2815016-2815038 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
925367942 2:3323920-3323942 TGGAGTAGGCAGCAAGGGTGAGG + Intronic
925839810 2:7980506-7980528 TGGGGGAGGCAGAAGGGAGATGG - Intergenic
926224478 2:10957281-10957303 TGGGGTAGGGAGCATGGGGGGGG - Intergenic
926753647 2:16219303-16219325 GGGGGGAGGGAGAAGGGGGGAGG - Intergenic
926795408 2:16615291-16615313 TGGGGGAGGCAGAAGAGAAGGGG - Intronic
926904627 2:17794401-17794423 TGGGGTGGGGAGTGGGGGCGGGG - Intronic
927200592 2:20575766-20575788 TGGGGTAGCCTGAAGGGGGGGGG - Intronic
927239213 2:20905594-20905616 TGGGGTGGGGAGAGGGGGCAGGG - Intergenic
927270819 2:21208714-21208736 TGGGGTGGGGAGAGGGGGCAGGG - Intergenic
927473908 2:23397410-23397432 TGGGGGAGGCAGCAGGGGTGGGG + Intronic
927854455 2:26519111-26519133 TGGGGATGGCAGAGGGGGCACGG + Intronic
928230560 2:29495160-29495182 TGGGGTAGGCAGGAGGGAGCTGG - Intronic
928537921 2:32258103-32258125 TGGGGTAGCCAGAAGGGAGATGG + Intronic
929339817 2:40801697-40801719 TGGGGTGGGGGGAGGGGGCGGGG - Intergenic
929582107 2:43087932-43087954 TGGGCAAGGCAGAAGAGGAGGGG + Intergenic
929779139 2:44946549-44946571 TGGGGAAGGCAGGAGGAGTGAGG + Intergenic
930700970 2:54457160-54457182 TGGGGACGGCAGAAAGGGCGGGG - Intronic
931785137 2:65611424-65611446 TGGGGGTGGCAGAAGGTGGGGGG + Intergenic
931878381 2:66539829-66539851 GGAGGCAGGCAGAAGGGGAGGGG - Intronic
931890950 2:66671402-66671424 TGGGGGAGGCAGAGGGGAAGGGG + Intergenic
932363525 2:71130285-71130307 GGCGGGAGGCAGAGGGGGCGGGG + Intergenic
932921649 2:75921542-75921564 TGGGGAAGGGAAAAGGGGAGGGG + Intergenic
933116574 2:78480204-78480226 TGGGGTAGGCGGAGGGGGGAGGG + Intergenic
933123809 2:78577072-78577094 TGGGGTGGGGAGAGGGGGGGAGG + Intergenic
933260643 2:80127602-80127624 AGGGGCAGGAAGAAGGGGCTAGG - Intronic
933776531 2:85774409-85774431 TGGGGCAGGTAGAAAGGGCATGG - Intronic
933957928 2:87386908-87386930 TAGAGTAGGAAGCAGGGGCGGGG + Intergenic
934061543 2:88298705-88298727 TGGGGTGGGGAGAAGGTGAGGGG + Intergenic
934114040 2:88766497-88766519 TGGGGTGGGGAGATGGGGTGAGG + Intergenic
934242050 2:90278826-90278848 TAGAGTAGGAAGCAGGGGCGGGG + Intergenic
934271123 2:91537862-91537884 TAGAGTAGGAAGCAGGGGCGGGG - Intergenic
934635989 2:95991197-95991219 TGGGGTGGGGAGATGGGGTGAGG - Intronic
934663788 2:96156813-96156835 GGGGGTGGGCAGACGGGGCCGGG - Intergenic
934797659 2:97114237-97114259 TGGGGTGGGGAGATGGGGTGAGG + Intronic
934835755 2:97589202-97589224 TGGGGTGGGGAGATGGGGTGAGG - Intronic
935263530 2:101375419-101375441 TGGGGGAGTAAGAAGGGGTGTGG + Intronic
935358236 2:102224923-102224945 TGGGGTGGGCAGAGGAGGGGAGG - Intronic
935618202 2:105107121-105107143 GTGGGGAGGCAGAAGGAGCGAGG - Intergenic
936229508 2:110687762-110687784 TTAGGTAGGCAGAAAGGGTGAGG + Intergenic
936589170 2:113786891-113786913 TGGGGTAGGGGGAGGGGGGGAGG - Intergenic
936749841 2:115628956-115628978 TGGGGTAGGGGGAAGGGGGAAGG - Intronic
937206445 2:120239744-120239766 TGGGGCCGTCAGGAGGGGCGTGG + Intergenic
937359379 2:121218503-121218525 TGAGGTGGGCAGCAGGGGCCAGG - Exonic
937554818 2:123141035-123141057 TGTGGTAGGGAGAAGGGGGAGGG - Intergenic
937597186 2:123686400-123686422 TGGGGTAGGGGGCAGGGACGAGG - Intergenic
937614439 2:123905022-123905044 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
937956740 2:127426061-127426083 TGAGGTAGGCAGAGGTGGTGAGG - Intronic
938386404 2:130870218-130870240 CAGGGTAGGCTGAAGGGGCAAGG + Intronic
941623420 2:167804468-167804490 TGGGGTGGGCAGAAGGGGGAGGG - Intergenic
943556904 2:189416561-189416583 TGGGGTAGGAGGAAGGGGGAGGG + Intergenic
943682880 2:190786388-190786410 GGGGGTGGGGAGGAGGGGCGGGG - Intergenic
943820974 2:192320429-192320451 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
943920726 2:193705043-193705065 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
943943477 2:194028908-194028930 TAGTGTAGGCAGATGGGGAGGGG + Intergenic
944306873 2:198188880-198188902 TGGGGAAGCCAGAAGGGGGGTGG - Intronic
944348491 2:198698356-198698378 TTGGGTAGCCAAAAGGGGAGAGG + Intergenic
945324116 2:208463158-208463180 TGGGGGAGGAAGAAGGGACCAGG - Intronic
945516950 2:210774195-210774217 TGGGGTAGGGAGAGGGGGGAGGG + Intergenic
945620991 2:212136793-212136815 TGGGGTGAGAAGAAGGGGTGTGG + Intronic
945958472 2:216107951-216107973 TCAGCTCGGCAGAAGGGGCGGGG - Intronic
946040228 2:216776592-216776614 TGGGGTTGGCAAAAGTGGGGAGG + Intergenic
946068545 2:217011225-217011247 TGGGGTAGGCGGATGGGGGAGGG - Intergenic
946095504 2:217270805-217270827 TGGGGTGGGCAGATTGGGTGTGG + Intergenic
946160461 2:217832609-217832631 TGGGGAAAGCAGCAGGGGCAGGG - Intronic
946420755 2:219563241-219563263 GGGGGAGGGCAGTAGGGGCGGGG + Intronic
946432205 2:219631886-219631908 TGGGTTGGGCAGAAGGAGCTGGG + Intronic
946444545 2:219727081-219727103 TGGGGAAGGCTGGAGGGGCCAGG + Intergenic
946838382 2:223795578-223795600 TAGGCCAGGCAGAAGGGGCCAGG + Intronic
947272971 2:228359109-228359131 TGGGGTGGGGGGAAGGGGGGAGG - Intergenic
947371744 2:229453688-229453710 TGGAGGAGGCAGAAAGGGTGGGG - Intronic
947874206 2:233457758-233457780 TGCAGTGGGCAGCAGGGGCGTGG + Intronic
948423886 2:237876215-237876237 TTGGGCAGGCAGATTGGGCGAGG - Intronic
948487538 2:238290283-238290305 TGTGTTAGGGAGAGGGGGCGGGG - Intergenic
948565671 2:238884625-238884647 TGGGGCAGGCAGCAGAGGCGAGG + Intronic
948585764 2:239018811-239018833 TGGGGAGGGCAGAGTGGGCGTGG - Intergenic
948609181 2:239155933-239155955 TGGGGTAGCAAGAAGGGCAGGGG - Intronic
948667214 2:239544097-239544119 TGGGGAAGGCACAAGAGGCAGGG + Intergenic
948705902 2:239792355-239792377 CTGGGAAGGCAGAAGGGGCTGGG - Intronic
1168806562 20:675423-675445 GGGGGTTGGGAGAAGAGGCGAGG - Intronic
1171539423 20:25934923-25934945 TGGGGTAGGGGGAAGGTGGGAGG - Intergenic
1171842353 20:30230147-30230169 TGGGGTAGGGGGGAGGGGGGAGG - Intergenic
1172030725 20:31980336-31980358 AGGGGTAGGCAGATGGGGAGGGG + Intronic
1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG + Exonic
1173484588 20:43431069-43431091 TGGGGAAGGCAGAGAGGGCAGGG + Intergenic
1173570439 20:44072134-44072156 TGGGGTTGGGGGAGGGGGCGTGG - Intergenic
1173825931 20:46047604-46047626 TGGGGAAGGCTGAAGGGTGGTGG + Intronic
1173850448 20:46214543-46214565 TGGAGAAGCCAGAAGGGGCCAGG - Intronic
1174181820 20:48679841-48679863 TGGGAGGGGCAGAGGGGGCGTGG - Intronic
1174736674 20:52972112-52972134 TCCGGGAGGCGGAAGGGGCGGGG - Intergenic
1175126341 20:56754815-56754837 GGGGGTAGGGAGAAGGGGAAGGG - Intergenic
1175748128 20:61475680-61475702 TGGGGTAGGGAGAAGAGAGGTGG - Intronic
1176612915 21:9002076-9002098 TGGGGTGGGGAGAGGGGGGGAGG + Intergenic
1176801809 21:13437480-13437502 TGGGGTAGGAAGTAGGGGGTAGG - Intergenic
1177322096 21:19535992-19536014 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1177571633 21:22894741-22894763 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
1178356554 21:31914077-31914099 TGGGGAAGGCAGGAGGAGAGTGG + Intronic
1178414533 21:32393102-32393124 TGGGACCGGCGGAAGGGGCGTGG + Intergenic
1178503561 21:33145365-33145387 TGGGGAGGGGAGAAGAGGCGAGG - Intergenic
1179037796 21:37774491-37774513 TGGGGTAGGGGGAGGGGGGGAGG - Intronic
1179085650 21:38215241-38215263 TGGGGTAGGGAGGAGGAGGGTGG + Intronic
1179264096 21:39786958-39786980 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1179459408 21:41523618-41523640 TGGGGTGGGCAGAAGATGGGAGG - Intronic
1179879136 21:44286233-44286255 TGGGGAAGGCTGGAGGGGCTTGG - Intronic
1179958846 21:44757104-44757126 TGGGGATGGCAGAGGTGGCGAGG - Intergenic
1180941806 22:19664304-19664326 TGGGGCAGGCTGTAGGGGCTGGG - Intergenic
1181167896 22:20993098-20993120 TGGGGCAGGCAGATGGTGCTGGG + Intronic
1181475787 22:23167107-23167129 TGGGGTTGGCAGCAGAGGCAGGG - Intergenic
1181619448 22:24078709-24078731 TGTGGTACACAGAAGGGGGGTGG - Intronic
1182123016 22:27799067-27799089 CTGGGTAGGCGGAAGGGGAGAGG + Exonic
1182331372 22:29553627-29553649 TGGGGCTGGGAGATGGGGCGGGG - Intronic
1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG + Intronic
1182556981 22:31134423-31134445 TGGGGTAGGCAGATGGGCCAAGG + Exonic
1183395365 22:37568337-37568359 TGGGGTTTGCAGTAGGGGCTGGG - Exonic
1183543516 22:38443460-38443482 TGGGGAAGGCAGGAGAGGGGAGG - Intronic
1184119018 22:42438406-42438428 GGTGGGGGGCAGAAGGGGCGGGG - Intergenic
1184390546 22:44200946-44200968 TCGGGGAGGCAGATGGGGCTTGG - Intronic
1184678202 22:46054582-46054604 GGTGGGAGGCAGAAGGGGCCTGG + Intronic
1184859036 22:47162960-47162982 TGGGGTTCGCAGATTGGGCGTGG - Intronic
1185035576 22:48475039-48475061 TGTGGGAGGCAGAGGGGGCGAGG - Intergenic
1185035592 22:48475077-48475099 TGCGGGAGGCAGAGGGGGCGAGG - Intergenic
1185287570 22:50009406-50009428 TGGGTGAGGCAGAAGGCGCCCGG + Intronic
1185336835 22:50274710-50274732 TGGGGGAGGTGGAAGGGGCTGGG - Intergenic
1185336895 22:50274836-50274858 TGGGGGAGGTGGAAGGGGCTGGG - Intergenic
949111857 3:270490-270512 AGGTGTAGGCAGAAAGGGCAGGG + Intronic
949868629 3:8568266-8568288 TGGAATAGGCAGGTGGGGCGGGG - Intergenic
950217525 3:11169908-11169930 TGGGGCATGGAGAAGGGGCATGG - Intronic
950633953 3:14302305-14302327 TGGTGTTGGCAGAAGGGGTCAGG - Intergenic
951833260 3:26953778-26953800 TGGGGTGGGCTGTAGGGGAGTGG - Intergenic
951837095 3:26995489-26995511 TGGGGTAGGGGGAACGGGGGAGG + Intergenic
952922924 3:38299282-38299304 TGGGGTAGACGGAATGGGAGGGG - Intronic
953295080 3:41707035-41707057 TGAGGTAGGCAGATGGGATGGGG - Intronic
954574052 3:51665158-51665180 TGGGGGATACAGAGGGGGCGGGG - Exonic
954792247 3:53142111-53142133 TCAAGTAGGCAGAAGGGGCTGGG - Intergenic
955113289 3:55971602-55971624 TGGGGTATGAAGAAGGGGGCTGG + Intronic
955322289 3:57982933-57982955 TGGTGTAGGCTGAAGGGGCATGG - Intergenic
956877798 3:73480582-73480604 TGGGGTAGGCAGGAGGGCCAGGG - Intronic
957644330 3:82901571-82901593 TGGGGTGGGGGGAAGGGGCAGGG - Intergenic
958663712 3:97106515-97106537 TGGGGAAGCCAGAAGGGGGATGG - Intronic
959182532 3:102999997-103000019 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
959993854 3:112659288-112659310 TGGGGTGGGCAGAGGGGGGAGGG - Intergenic
960966752 3:123110858-123110880 TGCTGTATGCAGGAGGGGCGGGG + Intronic
960972664 3:123150699-123150721 TGGAGAAGGAAGAGGGGGCGGGG - Intronic
961144844 3:124585005-124585027 TGGGGTAGGCGGATGGGGCTGGG + Intronic
962081431 3:132143061-132143083 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
962204461 3:133423553-133423575 TGGGGGAGGCGGCGGGGGCGGGG + Intronic
962367069 3:134793815-134793837 TGGGGTAGGAGGGAGGGGAGGGG + Intronic
963239514 3:142989239-142989261 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
963525516 3:146410176-146410198 TGGGGTAGGGGGCAGGGGCGAGG + Intronic
963742942 3:149097898-149097920 TGGGGGAGGGAGGAGGGGAGGGG + Intergenic
964584661 3:158284033-158284055 TGGGGTGGGGGGAAGGGGGGAGG - Intronic
964650966 3:159010845-159010867 TGGGGTAGGCAGAGGGGGGACGG - Intronic
965223566 3:165958969-165958991 TGGGGTGGGGGGAAGGGGGGAGG - Intergenic
966285774 3:178293766-178293788 TGGGGGAGCCAGAAGGGAAGTGG + Intergenic
966803919 3:183790927-183790949 TGGTGTAGGCACGAGGGACGTGG - Exonic
966851982 3:184170271-184170293 TGGGGCAGGCTGAGCGGGCGGGG - Intronic
966983856 3:185162060-185162082 GGGGGTAGGAAGGAGGGGAGAGG + Intergenic
968589852 4:1451949-1451971 TGGGGGAGGGAGAAGAGGAGGGG - Intergenic
968789928 4:2652551-2652573 TGGAGTAGGAGGAAGGGGGGTGG + Intronic
968891169 4:3369180-3369202 TGGGGGAGTCTGCAGGGGCGGGG - Intronic
969001885 4:3989189-3989211 TGGGGGAGCCAGAAGGGAGGTGG + Intergenic
969200396 4:5599571-5599593 TGGGGTGGGCAGAGGGGGGAGGG + Intronic
969405197 4:6987079-6987101 AGGGGCGGGCACAAGGGGCGGGG - Intronic
969439355 4:7208183-7208205 TGGGACATGCAGAAGGGGCTTGG + Intronic
969812034 4:9655622-9655644 TGGGGGAGCCAGAAGGGAGGTGG - Intergenic
969982104 4:11168312-11168334 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
970121186 4:12754132-12754154 TGGGGTGGGCAGAGGGGGGAGGG + Intergenic
970235235 4:13952262-13952284 TGGGGTAGAAAGGAGGGGGGTGG + Intergenic
970364125 4:15341622-15341644 TGGTGTAGACAGAAGTGGAGGGG - Intronic
972341295 4:38154853-38154875 TGGGGCAGGCAGCTGGGGTGGGG - Intergenic
972908540 4:43784038-43784060 TGTGGTAGGCAGAATGGGAATGG + Intergenic
973676889 4:53272701-53272723 TGGGGTGGGGGGAAGGGGAGAGG + Intronic
973791203 4:54379752-54379774 TGGGGTGGGAGGCAGGGGCGAGG - Intergenic
974349766 4:60730149-60730171 TGGGGTGGGGAGAGGGGGCAGGG - Intergenic
975252459 4:72196207-72196229 TGGGGTAGGGAGAGGGGGGAGGG - Intergenic
976373417 4:84316567-84316589 TGAGTCAGCCAGAAGGGGCGAGG + Intergenic
977091447 4:92681540-92681562 TGGGGTGGGGAGAAGGGGGAGGG + Intronic
977363381 4:96034782-96034804 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
977478520 4:97542974-97542996 TGGGGTGGGGAGAAGGGGGAGGG + Intronic
978695421 4:111571087-111571109 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
978744736 4:112179558-112179580 TGGGGTGGGGAGAAGGGGGAGGG + Intronic
979301638 4:119093682-119093704 TGGGGTAGGGAGAAGGAATGTGG - Intergenic
979818033 4:125134390-125134412 TGGGGTGGGCAGAGGGGGGAGGG + Intergenic
980795264 4:137674560-137674582 TGGGGTGGGGGGAAGGGGGGAGG - Intergenic
981570798 4:146148616-146148638 TGGGGCAGGCAGAGGGAGGGAGG + Intergenic
983440473 4:167777346-167777368 TGGGGTAGGGGGAAGGGGGAAGG - Intergenic
983891369 4:173033617-173033639 TGGAGTGGGCAGGAGGGGAGTGG - Intronic
984959927 4:185086570-185086592 TGAGGAAGTCAGTAGGGGCGGGG - Intergenic
985307076 4:188555104-188555126 AGGGGCAGGATGAAGGGGCGCGG - Intergenic
986109241 5:4694902-4694924 AGGGGGAGGCAGAAGAGGAGGGG + Intergenic
986598542 5:9448446-9448468 TGGGGTAGGCAGAAGGGGCGGGG - Intronic
987009910 5:13751855-13751877 TGGGTGGGGCAGAAGGGGAGAGG + Intronic
987050332 5:14143320-14143342 TGGGGAAGGAAGGAGGGGGGAGG - Intergenic
987447647 5:18040687-18040709 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
987561577 5:19530574-19530596 TGGGGTAGGGGGAAGGGGGAGGG - Intronic
987880188 5:23734428-23734450 TGGGGTGGGGGGAAGGGGGGAGG - Intergenic
989272912 5:39553643-39553665 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
989823045 5:45818606-45818628 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
990560627 5:56980054-56980076 TGGGGGAGCCAGAAGGGAGGTGG + Intergenic
990728849 5:58786495-58786517 TGGGCTGTGCTGAAGGGGCGGGG - Intronic
990825254 5:59892483-59892505 TGAGGGAGGGAGAAGGAGCGAGG - Intronic
990829086 5:59936211-59936233 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
992093648 5:73340611-73340633 TGGGGGAGGCAGAAGGGGGATGG - Intergenic
992658963 5:78939423-78939445 TGGGGTCGGGGGAAGGGGTGAGG - Intronic
992828181 5:80569839-80569861 TGGGAAAGGCAGGAGGCGCGAGG + Intronic
992849090 5:80785991-80786013 TGGGGTGGGGGGAAGGGGGGAGG + Intronic
993229201 5:85210351-85210373 TGGGTTAGGGGGAAGGGGGGAGG - Intergenic
994261561 5:97665447-97665469 TGGGGTGGGGGGAAGGGGGGAGG - Intergenic
994317492 5:98348986-98349008 TGGGGTAGGGTGAAGGGGGTGGG + Intergenic
994329979 5:98492934-98492956 TGGGGTCGGGGGAAGGGGGGAGG + Intergenic
994401831 5:99290061-99290083 TGGGGTTGGGGGAAGGGGGGAGG - Intergenic
995487949 5:112657947-112657969 TGGGGCAGGCAGAAAGTGCTGGG + Intergenic
996693712 5:126369138-126369160 TGGGGAAGGCAGAAAGGGAAAGG - Intronic
996819861 5:127614547-127614569 TGGGGTAGGGGGAAGGGGGACGG + Intergenic
996988231 5:129594785-129594807 TGGGGAAGGGAGAAGAGGAGGGG - Intronic
997185422 5:131876996-131877018 TGGGGTGGGGGGAGGGGGCGAGG + Intronic
997587700 5:135053347-135053369 TGGGGTGGTCAGAATGGGTGTGG + Intronic
997795457 5:136805350-136805372 TGGTTTGGGCAGAAGGGGAGAGG + Intergenic
998295513 5:140966279-140966301 GGGGGTAGGGAGAAAGGGAGTGG + Exonic
998370244 5:141656121-141656143 TGGGGCAGTCAGAAAGGGCAGGG + Intronic
998386065 5:141757811-141757833 TGGGGTCGGCAGGAGAGGTGTGG + Intergenic
998454864 5:142264082-142264104 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
998583820 5:143405078-143405100 TGGGGAAGGGAGCTGGGGCGGGG - Intronic
999830703 5:155316442-155316464 TGGGATAGGCAGGAGGGTTGTGG - Intergenic
1000024356 5:157346032-157346054 TGGGGTAGGCAGTTGGGATGGGG - Intronic
1000664589 5:163979549-163979571 TGGGGTGGGCAGAGGGGGGAGGG - Intergenic
1001207961 5:169781771-169781793 TGGGGGCGGGAGAGGGGGCGTGG - Intronic
1001381789 5:171310494-171310516 TGGGGGAGGCAGAGGGGGGCGGG - Intronic
1001382573 5:171314151-171314173 TGGGGGAGGGTGGAGGGGCGAGG - Intergenic
1001706060 5:173741795-173741817 AGGGGGAGGGAGAAGGGGAGAGG + Intergenic
1001798066 5:174518748-174518770 TGGGGTAGGCGGGTGGGGTGAGG - Intergenic
1001865174 5:175097685-175097707 TGGGGTGGGCAGCAGGGAGGTGG + Intergenic
1002260500 5:177990850-177990872 AGGGGTAGGGACAAGGGACGGGG - Intergenic
1002297856 5:178241348-178241370 GGGGGTAGGCAGAGGGGATGTGG + Intronic
1002792398 6:446014-446036 TGTGGTGAACAGAAGGGGCGGGG + Intergenic
1002812073 6:640259-640281 TGGGAGAGACAGAAGGGGTGCGG + Intronic
1002835442 6:861519-861541 GGGGGCAGGCAGAAGGTGTGCGG - Intergenic
1002888773 6:1316997-1317019 AGGGGTAGGCTGGAGGGGGGCGG - Intergenic
1002888824 6:1317088-1317110 AGGGGTAGGCTGGAGGGGGGCGG - Intergenic
1002888846 6:1317131-1317153 AGGGGTAGGCTGGAGGGGGGCGG - Intergenic
1002888884 6:1317206-1317228 GGGGGTAGGCTGGAGGGGGGCGG - Intergenic
1002888917 6:1317266-1317288 AGGGGTAGGCTGGAGGGGGGCGG - Intergenic
1002917833 6:1543051-1543073 TCGGAAAGGCAGAAGGGGCCTGG + Intergenic
1003425584 6:5996349-5996371 AGGGCGGGGCAGAAGGGGCGAGG - Intergenic
1003426173 6:5999679-5999701 GGAGGGAGACAGAAGGGGCGAGG - Intronic
1004086350 6:12453247-12453269 TGGAGTAGGCAGGAGGGGCTGGG + Intergenic
1004114232 6:12750229-12750251 TGGAGTGGGGAGAGGGGGCGGGG + Intronic
1004350098 6:14883406-14883428 AGGGGACGGCAGAAGGGGCAGGG + Intergenic
1005269817 6:24151566-24151588 TGGGGTGGGCGGAAGGGGGAGGG + Intronic
1005969468 6:30749876-30749898 TGGCGGAGGCAGAATGGGCAGGG + Intergenic
1005992747 6:30913787-30913809 TGGGGTCGGCAGGACGGGAGGGG - Intronic
1006088170 6:31611779-31611801 TGGGGCAGGCAGAGTGGGCTTGG - Intergenic
1006388221 6:33744077-33744099 TGGGGGAGGCAGAGGCTGCGAGG + Intronic
1007339891 6:41184570-41184592 TGGGGTAGGGAGAAGGGGGAGGG + Intergenic
1007444310 6:41894052-41894074 TGGGGTAGACTGCAGGGGGGTGG - Exonic
1007738967 6:43999731-43999753 TGGGGTACGCAGGTGGGCCGTGG - Intergenic
1007785246 6:44276074-44276096 TGGGGTAGGCGGCCCGGGCGCGG + Exonic
1009330965 6:62419133-62419155 TGGGGTGGGGAGCAGGGGGGAGG + Intergenic
1009662942 6:66636823-66636845 TGGGGTGGGCGGAAGGGGGAGGG + Intergenic
1009795483 6:68461691-68461713 TGGGGTTGGGAGAAGGGGGAGGG - Intergenic
1010190138 6:73186932-73186954 TGGGGTAGGGAGCAGGGGGAGGG - Intronic
1011525477 6:88259615-88259637 GGGGGGAGGCGGAAGGGGGGAGG + Intergenic
1012440198 6:99255180-99255202 TGGGGGAGGCAGAAGGGAGACGG - Intergenic
1012780906 6:103556713-103556735 TGGGGTGGGGGGAAGGGGGGAGG - Intergenic
1013276449 6:108589595-108589617 TGGGCTAGGCTGCAGGGGAGTGG - Intronic
1014247246 6:119081682-119081704 TGGGGTAGCCAGAAGGGAGATGG + Intronic
1016066581 6:139689099-139689121 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
1016472002 6:144384461-144384483 TGGGGGAGGCAGTGGGGGAGTGG - Intronic
1017359180 6:153545966-153545988 TGGGGAGGGCAGAAGGAGCATGG - Intergenic
1017872933 6:158502212-158502234 TGGGGGCGGCAGAGGGGGCGGGG - Exonic
1018067051 6:160131599-160131621 TGGGGGTGGCAGAGGGGACGGGG + Intronic
1019136560 6:169912166-169912188 TGGGGGAGCCAGAAGGGAGGTGG - Intergenic
1019556185 7:1632726-1632748 GGGGGGAGGCAGAAGAGGCAAGG - Intergenic
1019740718 7:2671569-2671591 CGGGGGAGGCAGAGGGTGCGTGG + Intergenic
1019774426 7:2904007-2904029 TGGTGAAGGCAGCAGGGGAGTGG - Intergenic
1020513694 7:9090470-9090492 TGGGGAAGGAAGAAAGGGCCTGG + Intergenic
1021092037 7:16495513-16495535 TGCTGTAGGCAGCAGGGGTGAGG + Intronic
1022283763 7:28935622-28935644 TGGGGCAGGCAGAGGGAGAGAGG + Intergenic
1022506317 7:30910414-30910436 TGGGGCAGGCAGGAGGTGGGAGG + Intergenic
1022692015 7:32665423-32665445 TGGGGAAGACAGATGGGGCAAGG + Intergenic
1022919684 7:34999976-34999998 TGGGGAAGACAGATGGGGCAAGG + Intronic
1023014722 7:35955753-35955775 CTGGGTAGGCAGCAGTGGCGTGG - Intergenic
1023382039 7:39618452-39618474 TGGGGTAGGATGAAGAGGTGGGG - Intergenic
1024066278 7:45739267-45739289 CTGGGTAGGCAGCAGTGGCGTGG + Intergenic
1024794745 7:53007715-53007737 TGGAGTAGGCACCAGGAGCGGGG - Intergenic
1025121597 7:56308695-56308717 TGGTGTAGGGGGAAGGGGGGAGG - Intergenic
1027397165 7:77767818-77767840 GGGGGGAGGGAGAAGGGGGGAGG - Intronic
1027397172 7:77767832-77767854 GGGGGGAGGGAGAAGGGGGGAGG - Intronic
1028164682 7:87524584-87524606 TGGGGTAGAGGGAAGGGGGGAGG + Intronic
1028306244 7:89269204-89269226 TGGGGTAGGGGGAAGGGGGAGGG - Intronic
1028394129 7:90348616-90348638 TGGCAGAGGCAGAAGGGGTGGGG + Intronic
1029190667 7:98769846-98769868 TGGGGGAAGCAGAAGGGAAGAGG - Intergenic
1029634447 7:101774597-101774619 TTTGGGAGGCAGAGGGGGCGTGG + Intergenic
1029710979 7:102299807-102299829 TGGGGCTGGCAGAAGAGGCTGGG - Intronic
1030542119 7:110843936-110843958 TGGGATAGGAGGAAGGGGCTGGG + Intronic
1030746563 7:113173039-113173061 TGGGGAAGCCAGAAGGGGAATGG - Intergenic
1031083314 7:117278758-117278780 TGAGGTAGGGAGAAGGAGCCAGG - Intronic
1031586350 7:123535154-123535176 AGCGGCAGGGAGAAGGGGCGGGG + Intergenic
1031799460 7:126223911-126223933 TGGTGCAGGCAGATGGGGAGGGG - Intergenic
1032062348 7:128735632-128735654 TGGAGCAGGAGGAAGGGGCGGGG + Intergenic
1032095238 7:128935005-128935027 TGGGGTGGGGAGCAGGGGGGAGG - Intergenic
1032476447 7:132214543-132214565 TGGGGTGGGAGGAAGGGGCAGGG - Intronic
1032506662 7:132440373-132440395 TGGAGAAGGCAGACGGGGCTGGG - Intronic
1033631260 7:143160354-143160376 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
1033973892 7:147075772-147075794 TGGGGTAGGGGGAAGGGGGAGGG - Intronic
1034349279 7:150405782-150405804 GGGGGCGGGGAGAAGGGGCGCGG + Intronic
1034423480 7:151001163-151001185 TGGTGGAGGAAGAATGGGCGAGG + Intronic
1034989373 7:155538484-155538506 TGGGGTTAGCAGGAGGGGGGTGG - Intergenic
1035105809 7:156440860-156440882 TGGGGGTGGGAGAAGGGCCGAGG - Intergenic
1035371081 7:158379256-158379278 TGGGGTTGGCAGGAGGACCGGGG + Intronic
1035609984 8:955420-955442 TGGGGCAGGCAGCAGTGGGGAGG - Intergenic
1035698038 8:1615077-1615099 TGGGGTTGCCAGAAGAGGTGGGG + Intronic
1036187082 8:6632172-6632194 TGGAGTAGGCAGGAAGGGAGTGG + Intronic
1036988594 8:13566346-13566368 GGGGGTGGGGAGCAGGGGCGGGG - Intergenic
1037905006 8:22711048-22711070 TGGGGTAGAAAGAAGTGGGGAGG + Intergenic
1037928725 8:22865103-22865125 GGGGGTAGACAGAAGGGCTGGGG + Intronic
1037934957 8:22909264-22909286 TGGGGTAGGGAGAAGGACCCTGG - Intronic
1038002359 8:23403120-23403142 TGGGCTGGTGAGAAGGGGCGCGG + Intronic
1038437418 8:27545677-27545699 GGGGGCAGGCAGAAAGGGCTCGG - Intergenic
1038950401 8:32408150-32408172 TGGGGTAGGCAGTGGGGAAGGGG + Intronic
1039086315 8:33783604-33783626 TGGGGGAGCCAGAAGGGGGATGG + Intergenic
1039127627 8:34220915-34220937 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
1039889663 8:41675753-41675775 TGGGGTTGGCAGAGGGGGAAAGG - Intronic
1040007314 8:42631369-42631391 TGGTGCAGGGAGAAGGGGAGTGG - Intergenic
1040335451 8:46413675-46413697 TGAGGTAGGCAGAAGGGAAGCGG + Intergenic
1040579845 8:48688945-48688967 TGGGGTAGGCAGAAGATGAGTGG + Intergenic
1042480370 8:69295887-69295909 TGGGGTGGGCAGGACGGGAGTGG - Intergenic
1043046494 8:75330071-75330093 TGGGGTGGGGAGAAGGGGGAGGG + Intergenic
1043705402 8:83342441-83342463 TGGGGTGGGCAGAGGGGGGAAGG + Intergenic
1044812360 8:96076401-96076423 TGGGGTAGGGGGAAGGGGGAAGG + Intergenic
1045540640 8:103081030-103081052 TGTGGCATGCAGAAGGGGCAGGG - Intergenic
1045969637 8:108065021-108065043 TGGGGTGGGGAGAAGGGGGAGGG + Intronic
1046318399 8:112537019-112537041 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1046837825 8:118822506-118822528 TTGCGTAGGCTGAAGGGGAGGGG + Intergenic
1046905707 8:119570306-119570328 TGGGGGAGGTTGAAGGGGGGTGG + Intronic
1046984383 8:120371000-120371022 TGGGGAAGGTACAAGGGGCGTGG + Intronic
1047203695 8:122786700-122786722 GGGGGGAGGCAGAAGGGGAATGG - Intronic
1047749307 8:127867724-127867746 TGGGGTGGGGAGAAGGGGACTGG + Intergenic
1048335548 8:133499602-133499624 TGGGGTAGACAGAAAGTGAGAGG + Intronic
1048373465 8:133801157-133801179 AGGGGCAGGCAGAATGGGAGGGG - Intergenic
1048614947 8:136063937-136063959 TGGGGTAGGGAGATGGGGGAGGG - Intergenic
1049204991 8:141359509-141359531 TGGGGGTGGCAGGAGGGGCTGGG - Intronic
1049653806 8:143789056-143789078 TGTGGAAGGCAGGAGGGGTGTGG + Intergenic
1049684840 8:143935148-143935170 TGGGGCAGGCAGCAGGGGAAGGG + Intronic
1050537891 9:6645823-6645845 GAGGGTAGGAAGAGGGGGCGGGG - Intergenic
1050650160 9:7767290-7767312 TGGGGTGGGAGGAAGGGGGGAGG - Intergenic
1051809949 9:21037184-21037206 TGGGGTAGGGAGCTGGGGAGAGG + Intergenic
1052028660 9:23603842-23603864 TGGGGAAGAGCGAAGGGGCGGGG - Intergenic
1052114913 9:24638879-24638901 TGGGGTAGGCAGAGGGGGGAGGG - Intergenic
1053265322 9:36708878-36708900 TGGGGAAGGCAGAAGAGGTCTGG - Intergenic
1053297472 9:36925090-36925112 GGTGGCAGGCAGAAGGGGCTGGG + Intronic
1053427058 9:38017138-38017160 GGGGCTAAGCAGGAGGGGCGTGG - Intronic
1053477199 9:38391081-38391103 TGGGGGAGGCAGGAGGGCCTTGG + Intergenic
1053792622 9:41697573-41697595 TGGGTAAGGTAGAAGGGGCAGGG - Intergenic
1054181036 9:61909594-61909616 TGGGTAAGGTAGAAGGGGCAGGG - Intergenic
1054472329 9:65548395-65548417 TGGGTAAGGTAGAAGGGGCAGGG + Intergenic
1054656555 9:67671548-67671570 TGGGTAAGGTAGAAGGGGCAGGG + Intergenic
1055365694 9:75542353-75542375 TGGGGAAGAGAGAAGGGGTGGGG + Intergenic
1055397784 9:75892158-75892180 TTGGGCAGGCAGCAGGGGCGCGG + Intronic
1056096005 9:83254115-83254137 TGGGGTAGGGGGAAGGGGGAGGG + Intronic
1056512827 9:87321868-87321890 TGGAGTAGGAGGAAGGGGCTGGG - Intergenic
1056817428 9:89811817-89811839 TGGGGTGGGGAGGAGGGCCGGGG + Intergenic
1056832721 9:89929810-89929832 TGGGGAAGGGAGCAGGGGCTGGG + Intergenic
1056832729 9:89929829-89929851 TGGGGAAGGGAGCAGGGGCTGGG + Intergenic
1057505127 9:95627393-95627415 TGGGGTAGGGGCATGGGGCGTGG - Intergenic
1057533838 9:95878647-95878669 TGGGGTGGGGGGAAGGGGGGAGG - Intronic
1057840965 9:98485287-98485309 TGGGGTAGGAAAATGGGGAGGGG + Intronic
1058029092 9:100176111-100176133 TGAGGGAGGCAGGAGGGGAGAGG - Intronic
1059499310 9:114737507-114737529 AGGGAGAGGCAGAAGGGGAGGGG - Intergenic
1061246048 9:129401748-129401770 AGGGGGAGGGAGAAGGGGGGAGG - Intergenic
1061886565 9:133593933-133593955 TGGGGGTGGCAGAGGGGGAGTGG - Intergenic
1061904135 9:133688042-133688064 TGGGGGAGGCAGGTGGGCCGTGG - Intronic
1061947172 9:133914799-133914821 AGGGGAAGGGAGAAGGGGAGGGG + Intronic
1062338773 9:136084269-136084291 TGGGGCATGCAGTAGGGGAGGGG - Intronic
1062526591 9:136980353-136980375 TGGGGGAGGCAGAGGGGAGGAGG + Intronic
1185596903 X:1312773-1312795 TGGGGTTTGCAGGAGGGACGTGG - Intergenic
1186575703 X:10763306-10763328 TGGGGTGGGGGGAAGGGGGGAGG - Intronic
1190222582 X:48521922-48521944 TGGGGGAGGGAGCAGGGGCCGGG - Intronic
1190392122 X:49942545-49942567 TGGGGTAGGGGGGAGGGGGGAGG - Intronic
1190544583 X:51512458-51512480 TGGGGTGGGGGGAAGGGGGGAGG - Intergenic
1190845058 X:54183386-54183408 TTGGGTAGAGAGAAGGGGAGGGG + Intergenic
1191757566 X:64610359-64610381 TGGGGTAGGGAGAGGGGGGAGGG - Intergenic
1191985032 X:66970482-66970504 TGGGGTGGGGAGGAGGGGGGAGG - Intergenic
1192183714 X:68931665-68931687 TGGGGTGGGGAGTAGGGGAGAGG + Intergenic
1192318620 X:70070568-70070590 AGGTGGAGGCGGAAGGGGCGAGG - Intergenic
1192321260 X:70092392-70092414 TGGGGTAGGGAGAAGTGGGAAGG + Intergenic
1192637442 X:72832645-72832667 TGGGGAGGGCAGGAGGGGAGGGG + Intronic
1192780136 X:74285767-74285789 TTGGGGAGGCACAAGGGGAGGGG + Intergenic
1193116441 X:77780250-77780272 TGGGTTAGGGAGAAGGGTAGTGG - Intronic
1193316951 X:80076010-80076032 TGGGGTTGGGAGAAGGGGGAGGG + Intergenic
1193632586 X:83908564-83908586 TGGGGTAGGGGGAGGGGGCAGGG - Intergenic
1194139349 X:90190868-90190890 TGGGGTAGGCAGGGGAGGGGAGG - Intergenic
1194512507 X:94813351-94813373 TGGGGTGGGGGGAAGGGGGGAGG + Intergenic
1195343479 X:103926550-103926572 TGGAGCAGGGAGAAGGGGCTAGG + Intronic
1195363489 X:104106769-104106791 TGGAGCAGGGAGAAGGGGCTAGG - Intronic
1195668251 X:107449578-107449600 AGGGGAGGGGAGAAGGGGCGGGG - Intergenic
1195887144 X:109650527-109650549 TGGGGTGGGGGGAAGGGGGGAGG + Intronic
1195887370 X:109653805-109653827 TGGGGTGGGCGGAAGGGGGAGGG + Intronic
1196171787 X:112596118-112596140 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
1196242066 X:113353424-113353446 TGGGGGAGCCAGAAGGGGGATGG - Intergenic
1197373953 X:125659269-125659291 TGGGGTAGGGGGAAGGGGGAGGG + Intergenic
1197659682 X:129156749-129156771 TGGGGTAGGGAGAGGGGGGAGGG - Intergenic
1197968805 X:132093696-132093718 TGGGGTAAGCAGAGGGAGTGGGG + Intronic
1198553101 X:137765072-137765094 TGGGGTAGGGGGAAGGGGGAGGG - Intergenic
1199080736 X:143574332-143574354 TGGGGTGGGGAGAAGGGGGAGGG - Intergenic
1199336366 X:146622483-146622505 TGGGGTGGGGGGAAGGGGGGAGG - Intergenic
1199544667 X:148995458-148995480 TGGGGAGGGCAGAAAGGGGGTGG + Exonic
1199929354 X:152502947-152502969 TGGGGTGGGGGGAAGGGGCAGGG + Intergenic
1199944450 X:152654000-152654022 TGGGGTTGGCAGAGGGTGGGGGG + Exonic
1199966786 X:152826817-152826839 GTGGGGAGGCAGAAGGGGTGAGG - Intergenic
1200352423 X:155512309-155512331 TGGGGTGGGGGGAAGGGGGGAGG - Intronic
1200485094 Y:3759803-3759825 TGGGGTAGGCAGGGGAGGGGAGG - Intergenic
1200804823 Y:7422489-7422511 TGGGGAAGGGAGAGGGGGCAGGG - Intergenic
1200907698 Y:8501481-8501503 TGGGGTGGGCAGATGGGGGAGGG - Intergenic
1202584760 Y:26410246-26410268 TGGGGTGGGGAGATGGGGTGAGG + Intergenic