ID: 986598840

View in Genome Browser
Species Human (GRCh38)
Location 5:9450995-9451017
Sequence AAAGGCTTGTATAACTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986598838_986598840 7 Left 986598838 5:9450965-9450987 CCTAATAATTGAATACAGAGCTT 0: 1
1: 0
2: 0
3: 20
4: 271
Right 986598840 5:9450995-9451017 AAAGGCTTGTATAACTCTGAAGG 0: 1
1: 0
2: 0
3: 13
4: 136
986598837_986598840 23 Left 986598837 5:9450949-9450971 CCATAAGAGAAATCAGCCTAATA 0: 1
1: 0
2: 1
3: 12
4: 203
Right 986598840 5:9450995-9451017 AAAGGCTTGTATAACTCTGAAGG 0: 1
1: 0
2: 0
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986598840 Original CRISPR AAAGGCTTGTATAACTCTGA AGG Intronic
900903526 1:5534306-5534328 AAAGGCTTGCAAAACAGTGAGGG - Intergenic
909185136 1:72477847-72477869 TAATTCTGGTATAACTCTGAAGG + Intergenic
909851887 1:80476990-80477012 CAGGGCTTGTAAAACTCTGTTGG - Intergenic
911555015 1:99333268-99333290 AAAGGATTTTATCACTTTGATGG + Intergenic
912672088 1:111639225-111639247 AAATCTATGTATAACTCTGAAGG - Intronic
914712020 1:150223016-150223038 AAAAACTTTTATAACTTTGAAGG + Intronic
917680489 1:177361205-177361227 AACTCGTTGTATAACTCTGATGG + Intergenic
919269914 1:195327119-195327141 AAATCCTTTTATAAATCTGAAGG + Intergenic
919680807 1:200432647-200432669 AAATGCCTTTATAATTCTGAGGG - Intergenic
920070113 1:203296645-203296667 AAAGGCATGTATTCCCCTGAGGG - Intergenic
923894888 1:238259362-238259384 AAAGGCAGGAATAGCTCTGAAGG + Intergenic
1063684487 10:8223725-8223747 AAATGTTTGTGAAACTCTGATGG + Intergenic
1066673684 10:37865515-37865537 AAAGGCTTACATAAATATGAAGG - Intergenic
1068204283 10:53828758-53828780 AATGGCTTGAATGACTCTAACGG - Intronic
1068253560 10:54476718-54476740 AAAGGTTTCTAGAAGTCTGAAGG - Intronic
1070917404 10:80163757-80163779 ACAGGCTTGTATATCCCTGGAGG - Intronic
1071282221 10:84113206-84113228 AAAGGCCTGTTAAACTCTGGAGG + Intergenic
1071366330 10:84904169-84904191 AAGGCCTTGGATAACTCTCAGGG - Intergenic
1073241787 10:102063992-102064014 AAAGGCAAATAAAACTCTGAAGG + Intergenic
1073522032 10:104141252-104141274 AAAAGATTGTATAATTTTGACGG + Intronic
1078095858 11:8296724-8296746 AAAGCCTCGTATAAATTTGAGGG - Intergenic
1078292453 11:10026312-10026334 AAAAGGTTGTATACCTCTAAAGG - Intronic
1078935550 11:15946334-15946356 CCAGGCTTGTCTAACTCTGAAGG - Intergenic
1080534509 11:33208341-33208363 TAAGACATGTATAGCTCTGATGG - Intergenic
1080955952 11:37095721-37095743 ACAGGCTTGTATATATCTTATGG - Intergenic
1082146945 11:48682037-48682059 AAAGAATGGTTTAACTCTGAGGG - Intergenic
1085326780 11:75612434-75612456 AAAGGAATGCTTAACTCTGAAGG + Intronic
1085586274 11:77710080-77710102 AAAGGCATGTATAGCTCTCTTGG - Intronic
1087224027 11:95577951-95577973 ATAGGCTAGAATAACTCAGAGGG - Intergenic
1090034668 11:123238384-123238406 CCAGGCTTGGCTAACTCTGATGG + Intergenic
1090489934 11:127151025-127151047 AAAGGTTTGAATAAATGTGAGGG - Intergenic
1092087838 12:5778837-5778859 AAAGGCTTATAGAATTTTGATGG + Intronic
1093243858 12:16711375-16711397 AAAGGCTGTTACAATTCTGAAGG + Intergenic
1093289298 12:17301616-17301638 AAAGGCCTGTTAAACTCTGGGGG + Intergenic
1094362733 12:29647666-29647688 AAAGGCTTGTATTACTTTGTAGG - Intronic
1094879837 12:34709351-34709373 AAAGGAGGGTATAACTCTGTGGG - Intergenic
1095506054 12:42899502-42899524 AAAGGTTTGTAAAACGCTAAAGG - Intergenic
1097396236 12:59078240-59078262 CAAAGCTTGTATAACTCTTTGGG - Intergenic
1099666325 12:85633989-85634011 AAAGCCTAGTAAAAATCTGAAGG - Intergenic
1100891473 12:99130970-99130992 GAAGTCTTGTTTAACTCTGTGGG - Intronic
1103330653 12:120151556-120151578 ACAGTGTTGTATACCTCTGAGGG + Intronic
1104150775 12:126080671-126080693 ACTGGCTTTCATAACTCTGAGGG + Intergenic
1104292911 12:127485584-127485606 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1110966063 13:81698431-81698453 AAAAGTTTGTATAACTTTGATGG + Intergenic
1111695320 13:91616074-91616096 AAAGGCTTGTATTAATCTGCTGG + Intronic
1111851417 13:93580407-93580429 AAAACCTTTTATCACTCTGAAGG + Intronic
1114889328 14:26897232-26897254 AAAGGATTGTGTAGCTCAGAGGG + Intergenic
1115945695 14:38657658-38657680 CAAGGGTTGTCTAACTCTGCAGG + Intergenic
1116533581 14:46003556-46003578 AAAGGCTTGAACAATTCTTATGG + Intergenic
1118505674 14:66408622-66408644 TAATGCATGTATGACTCTGAGGG + Intergenic
1118823535 14:69360770-69360792 AGAGGCTTGTTAAACTCAGAGGG - Intergenic
1125087990 15:35753650-35753672 AAATTCCTTTATAACTCTGAGGG - Intergenic
1126030144 15:44488894-44488916 GAAGGTGTGTATATCTCTGAAGG + Intronic
1133831728 16:9329651-9329673 GAAGTCTTTTATGACTCTGATGG - Intergenic
1135215402 16:20562410-20562432 AAAAAGTAGTATAACTCTGATGG - Intronic
1144076703 17:11725988-11726010 AAAGCCTTGAATTACTATGAGGG - Intronic
1145872170 17:28283755-28283777 AAAGGGAGGTATAACTATGAAGG - Intergenic
1146079204 17:29761645-29761667 AAAGGCTTGCATTTCTCTAAAGG + Intronic
1154408897 18:14124610-14124632 AAAGCATTCTATAACTCTGAGGG + Intronic
1155811629 18:30243538-30243560 ATATGCTTATATCACTCTGATGG + Intergenic
1157053018 18:44191613-44191635 ACAGTGTTGTATAACACTGAGGG - Intergenic
1159071971 18:63634504-63634526 AAAGGCTTATTTTACTCTGTTGG + Intergenic
1160140250 18:76314896-76314918 AAAGGCTGGTTTATCTCTAAAGG - Intergenic
1163281107 19:16318313-16318335 CAAGGCTTGCAGAGCTCTGAGGG + Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1164971189 19:32533991-32534013 AAAGGCTTGTTTAACTTCCAGGG + Intergenic
1165015672 19:32878332-32878354 AAAGGTTTGTACAACTTAGAGGG + Intergenic
926078908 2:9967419-9967441 AATGGCTTGTTTTATTCTGAAGG + Intronic
929273095 2:39995760-39995782 AAAGTCTTCTATAAATCTTAGGG + Intergenic
930518552 2:52435521-52435543 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
931917686 2:66976548-66976570 ATAAACTGGTATAACTCTGAAGG + Intergenic
936636810 2:114268027-114268049 CTTGGCTTGTATAACTTTGAAGG + Intergenic
942217299 2:173733919-173733941 TAAGGCTTGCACAACTCTAAGGG - Intergenic
943996431 2:194771928-194771950 AAAGTCTGGTAGAACTCTGCTGG + Intergenic
945485144 2:210386601-210386623 AAATGTTTGTAAAATTCTGAAGG + Intergenic
947009811 2:225553121-225553143 CAAGGCTTGTGGAGCTCTGACGG + Intronic
948670493 2:239565428-239565450 GAAGGCATGTAGAAGTCTGAAGG + Intergenic
1170821971 20:19761856-19761878 AAAGGCTGGTTGAAATCTGAAGG - Intergenic
1172502711 20:35438244-35438266 GGAGGCTTGTATAAGGCTGAGGG + Intronic
1174935287 20:54861205-54861227 AAAAACCTGTATACCTCTGACGG + Intergenic
1176733935 21:10524840-10524862 ATGAGCTGGTATAACTCTGAAGG + Intronic
1177113820 21:17061443-17061465 AAAGGCTTGTTTTACTTTGGTGG - Intergenic
1178239605 21:30883537-30883559 AAAGGTTTGTACAACTCAGCCGG + Intergenic
1181853363 22:25765715-25765737 AAAGGCTTTGATGACTTTGAAGG + Intronic
949158118 3:851155-851177 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
949884564 3:8682968-8682990 AAAGGCCTATTTAACTCTGGGGG + Intronic
950125682 3:10508490-10508512 AAAGGCTTGAATGAGTCTGCTGG + Intronic
950557921 3:13706389-13706411 AAAGGCTGGTCTACCACTGAGGG + Intergenic
955267323 3:57457848-57457870 AAAGCCATGTATAGCTCTGAGGG - Intronic
955976347 3:64484167-64484189 AAAGGCTTTGATAATTCTGATGG + Intergenic
956691129 3:71878473-71878495 CAAGGCATCTCTAACTCTGATGG - Intergenic
958217462 3:90606931-90606953 AAAGGAATGTTTAACTCTGCGGG + Intergenic
959357627 3:105353129-105353151 AAAGGCCTGTTCAAGTCTGAGGG - Intergenic
962879069 3:139559171-139559193 AAAACCTTGTATAATTTTGAAGG + Intergenic
963170370 3:142244058-142244080 AAAAGCTTGTTTAAGTCTGTTGG + Intergenic
965537954 3:169843610-169843632 AAAAGCTTATATAAATGTGAGGG - Intronic
967451370 3:189627147-189627169 CAAGACTGCTATAACTCTGAAGG - Intergenic
972958211 4:44418656-44418678 AAAGGCATGTCTAATTCTGAAGG - Intronic
974433307 4:61826616-61826638 AAAGCTGTGAATAACTCTGAAGG + Intronic
976931833 4:90575612-90575634 AGAGGCTTGTGTAACATTGACGG - Intronic
978723670 4:111945299-111945321 AAAGCCCTGTAGATCTCTGAAGG - Intergenic
978881350 4:113706946-113706968 AAAGACTTGCATAAGTATGAAGG - Intronic
982635655 4:157893637-157893659 CAATGCTTCTATAACTGTGAGGG + Intergenic
982991643 4:162284304-162284326 AAAAGAGTGTATAAATCTGATGG + Intergenic
986598840 5:9450995-9451017 AAAGGCTTGTATAACTCTGAAGG + Intronic
987929160 5:24381006-24381028 AAGGTCCTGTATAAATCTGATGG + Intergenic
990767362 5:59200971-59200993 AAAGGCATGTATAATTTTTATGG - Intronic
991638677 5:68732277-68732299 AAAGCCTTGGAGCACTCTGAGGG - Intergenic
993320473 5:86463358-86463380 AAAGGCTTGTTAAACTCTGGAGG + Intergenic
993676989 5:90827841-90827863 AAACACTTGGATAATTCTGAAGG + Intronic
994925955 5:106117652-106117674 AATTGCTTGTATAATTCTGTTGG - Intergenic
994944080 5:106362388-106362410 AAAGGCTTATACACTTCTGAAGG - Intergenic
997479163 5:134170194-134170216 AAAGGCTTTTATGACTGTAAAGG + Intronic
1000853979 5:166377207-166377229 AAATACTTGCATAACTTTGAAGG + Intergenic
1000863327 5:166483232-166483254 GAATGATTGTATAACTCTTAAGG + Intergenic
1004522757 6:16377807-16377829 AAATGCTTGTAAAACTATGGCGG + Intronic
1004679975 6:17883991-17884013 AAAGGAATGTAGAACTATGAGGG + Intronic
1008433596 6:51449282-51449304 ATAGGCTTGTATAATTATGGAGG - Intergenic
1010954823 6:82078236-82078258 AAAGGATAGGATAACTCTCAGGG + Intergenic
1012611689 6:101227133-101227155 AAAGGCCTGTTGAACTCTGGGGG - Intergenic
1014386390 6:120807126-120807148 AAATGCTTATATAAATGTGATGG + Intergenic
1017583219 6:155890137-155890159 CATGGCTTGAATACCTCTGAAGG + Intergenic
1021214371 7:17898839-17898861 TAAGAGTTGTATAACTCTGAGGG - Intronic
1023097567 7:36677463-36677485 AAAAGCTTGTACAATGCTGATGG + Intronic
1024775633 7:52782240-52782262 TAAGGCTTGACTAAATCTGAAGG - Intergenic
1025586159 7:62790588-62790610 AAAGGATGGTTTAACTCTGCTGG - Intergenic
1031678458 7:124640512-124640534 AAAGGCTTGTTTTACACAGACGG - Intergenic
1032170776 7:129582843-129582865 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1032431638 7:131866736-131866758 AAAGCCTTGTATAACTTTCTAGG + Intergenic
1032760460 7:134936057-134936079 AAAGGCTTGAAAAACACTGCTGG + Intronic
1033004780 7:137549678-137549700 AAAGGCTTGAAGGACTCAGAAGG + Intronic
1039064409 8:33596634-33596656 AAATCCTTGTATAACTTTGAGGG + Intronic
1040115942 8:43619278-43619300 AAAGAATGGTTTAACTCTGAGGG - Intergenic
1041977296 8:63814653-63814675 CAAGGCTTGTTTGACTCTTAAGG - Intergenic
1042712170 8:71730375-71730397 GAAGGCTTGTATAATTCAGAAGG + Intergenic
1044384798 8:91575049-91575071 AATGGCCAGTTTAACTCTGAAGG + Intergenic
1046729727 8:117712030-117712052 AAGGGATTATTTAACTCTGATGG - Intergenic
1046939229 8:119914816-119914838 AAGGGCTTGTAAAACACAGAAGG - Intronic
1049625945 8:143621049-143621071 AAATGTTTGTATGACTATGAAGG - Intergenic
1049841480 8:144775906-144775928 AAAAGATTGGATAGCTCTGATGG - Intronic
1050843424 9:10183404-10183426 TAAGGAATGTATATCTCTGAAGG + Intronic
1052498830 9:29262153-29262175 AAAGCCTTGGCTAACTCAGAGGG + Intergenic
1055811807 9:80157424-80157446 AAAGGAACATATAACTCTGATGG + Intergenic
1188943707 X:36270147-36270169 ATATGCTTTTATACCTCTGAGGG + Intronic
1189660223 X:43288546-43288568 AAAGGCTTATAATAGTCTGAGGG + Intergenic
1193599919 X:83498616-83498638 ACAGGCTTGTATTAATCTCAAGG + Intergenic
1195546749 X:106120999-106121021 AAAGGGTTGTATAATTCAGTTGG - Intergenic
1197473187 X:126888522-126888544 AAAGGCATGTATAACTCGTATGG + Intergenic
1198469287 X:136930976-136930998 AAAGGCTTACACAACTCTAAGGG + Intergenic
1200328634 X:155270238-155270260 TAAAGCTAGTATAAATCTGAAGG - Intergenic