ID: 986599470

View in Genome Browser
Species Human (GRCh38)
Location 5:9457311-9457333
Sequence CACTCTGCACAGGTAGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986599470 Original CRISPR CACTCTGCACAGGTAGAAAT TGG (reversed) Intronic
900918783 1:5657784-5657806 CACTCTGCTCATCTGGAAATGGG + Intergenic
901415012 1:9110639-9110661 CAGTCTGCACATGTGGAACTAGG - Intronic
902107135 1:14047181-14047203 TGCTCTTCACTGGTAGAAATAGG + Intergenic
904369908 1:30041898-30041920 CACTATGCACAGGGTGAACTGGG + Intergenic
904492124 1:30867738-30867760 CAGTCTGCACAGCTATAAAATGG - Intergenic
905390432 1:37632966-37632988 CACTCTACACAGATAGAATGGGG + Intronic
905875527 1:41429717-41429739 CATTCTCCAGATGTAGAAATGGG + Intergenic
906243972 1:44260329-44260351 CTCACTGCACAGGCAGCAATTGG + Intronic
906700295 1:47852721-47852743 CATTCTGCAGATGAAGAAATGGG + Intronic
909825048 1:80117229-80117251 CAGTCTGCACAGAAAGAAAGAGG + Intergenic
910676603 1:89821763-89821785 CACCCTGCACAGGAAGGAAGCGG - Intronic
911222471 1:95263443-95263465 CACTGTGCCTAGGTAGAAATTGG - Intergenic
912778491 1:112522569-112522591 CACTCTGCACAGGCAGCAGGAGG + Exonic
913672793 1:121113719-121113741 AACACTGCACATGTAGAAATGGG - Intergenic
914024569 1:143901093-143901115 AACACTGCACATGTAGAAATGGG - Intergenic
914663054 1:149809114-149809136 AACACTGCACATGTAGAAATGGG - Intronic
918658743 1:187062730-187062752 AACATTGCACAGCTAGAAATCGG - Intergenic
918985836 1:191624120-191624142 CAATGTGCTCAGCTAGAAATTGG - Intergenic
919660583 1:200240852-200240874 AACTCTGCACAGGCATAAACAGG + Intergenic
920358758 1:205397028-205397050 AAATCAGCACAGTTAGAAATGGG - Intronic
920833158 1:209483280-209483302 CAGGTTGCACAGTTAGAAATTGG - Intergenic
922057898 1:222059005-222059027 TACTTTGCACAGGTAGAGAATGG - Intergenic
922289310 1:224197443-224197465 CACTTTTCACAGGAAGAAACAGG + Intergenic
1062971878 10:1654517-1654539 CACACTGCACAGGTGGAAAGAGG - Intronic
1063596835 10:7442899-7442921 TTCTCTGCAGAGGTAGGAATTGG + Intergenic
1064055509 10:12093958-12093980 CAATCCTCACAGGTAGATATTGG - Intronic
1064564833 10:16629345-16629367 CTCTTGGCACAGGTAGAGATTGG - Intronic
1065865211 10:29909117-29909139 CATTTTGCACAGGAGGAAATGGG - Intergenic
1066222167 10:33345688-33345710 CAATATGTACAGGTAGACATAGG - Intergenic
1067764518 10:49075083-49075105 CACTGTGCACAGGTGCAAATGGG + Intronic
1069852947 10:71422386-71422408 CACTTTGCAGATGAAGAAATGGG - Intronic
1070110731 10:73484570-73484592 AACTCTGGAAAAGTAGAAATAGG - Intronic
1070864986 10:79703108-79703130 CACTGTGCACAGTTTGAATTTGG + Intergenic
1070878775 10:79841239-79841261 CACTGTGCACAGTTTGAATTTGG + Intergenic
1071631881 10:87225329-87225351 CACTGTGCACAGTTTGAATTTGG + Intergenic
1071645336 10:87357549-87357571 CACTGTGCACAGTTTGAATTTGG + Intergenic
1072913436 10:99522859-99522881 CACTCTGCCGAGGGAGAAGTAGG - Intergenic
1075841394 10:125507602-125507624 AAGTCTGCACATGTGGAAATAGG - Intergenic
1077134935 11:993783-993805 GACGCTGCACAGGTGGAACTTGG - Exonic
1078026604 11:7701415-7701437 CACTCTTCCCAGGTCAAAATAGG + Exonic
1078877711 11:15414649-15414671 CACTCTGGATTGGTAGAATTTGG + Intergenic
1079417732 11:20255177-20255199 CACTCTGTACAGGAACAAACTGG + Intergenic
1081197137 11:40175554-40175576 CACTCTGCAGAGGAAGAGGTTGG - Intronic
1081623138 11:44630917-44630939 CACTCTGCTTAGGAGGAAATGGG + Intergenic
1082581689 11:54877811-54877833 CAATCTGCAAAGGTATATATTGG - Intergenic
1083190301 11:61046925-61046947 CAATCTGCACAGCTAAGAATAGG + Intergenic
1083262413 11:61530451-61530473 CACTCTGCAGATGTAAAAACAGG - Intronic
1085760154 11:79234607-79234629 CACTCTGCAGAGGTGGAAGAAGG - Intronic
1095039281 12:37423696-37423718 CCCCCTGCACCGGTAGAAGTCGG - Intergenic
1099139153 12:78948767-78948789 CACAGTGCACAGGAAGAAAATGG - Intronic
1099163511 12:79274436-79274458 CAGTCTGCACAGGAAGAGAGGGG - Intronic
1100713546 12:97282670-97282692 CACTTTTCTCAGGTAGAAGTAGG - Intergenic
1106273124 13:28173803-28173825 AAATCTGCAGAGGTAGCAATAGG - Intronic
1107285288 13:38783442-38783464 CAGCCTGCTCAAGTAGAAATGGG + Intronic
1110297845 13:73889452-73889474 CACTTTGCACATCAAGAAATGGG + Intronic
1113295849 13:108957733-108957755 TTCTCTGAACAGGGAGAAATTGG + Exonic
1115543477 14:34444049-34444071 CATTTTGCACAGGGAGAAAGCGG - Intronic
1116616363 14:47145293-47145315 CACACTGCAATGGTAGAGATGGG - Intronic
1119615957 14:76099366-76099388 CACTCAACACAGGTAGAACAAGG + Intergenic
1121319182 14:92981204-92981226 GACTCTGGTCAGGAAGAAATAGG - Intronic
1121558362 14:94855647-94855669 GCTTCTGCACAGGTGGAAATGGG - Intergenic
1122034698 14:98938836-98938858 CTCTCTGCACAGTTTAAAATGGG + Intergenic
1124806303 15:32886791-32886813 CCCTCTCCACTGGTAGAATTAGG - Intronic
1124891296 15:33735864-33735886 AACTCTGCAGAGGGAGAAACTGG - Intronic
1131659131 15:94495289-94495311 GGCTCAGCTCAGGTAGAAATTGG + Intergenic
1133293593 16:4738592-4738614 CACTGTGCTCAGCCAGAAATGGG - Intronic
1137583189 16:49646964-49646986 CACTTTGCACAGTTATAAAAAGG - Intronic
1139309502 16:66016453-66016475 CACCCAGCACAGGTAGTAAGGGG + Intergenic
1141235706 16:82214018-82214040 CCCTTTGCATAGGTGGAAATAGG + Intergenic
1141635082 16:85310264-85310286 CACTTTGCACATCTGGAAATGGG + Intergenic
1141961612 16:87412866-87412888 CATTCTGCACAGGGAGAACCTGG + Exonic
1143743017 17:8967413-8967435 CACTGTGCAAAGGAAGAAAATGG + Intergenic
1147757532 17:42778938-42778960 AACTCTGAACAGGGAGAGATAGG - Exonic
1153816282 18:8793009-8793031 CACTCTGCTCAGGTAAAACGGGG - Exonic
1157681370 18:49609887-49609909 CACTCTGCACATGTATCCATTGG + Intergenic
1160142417 18:76337510-76337532 TACTCTGCACATGCCGAAATTGG - Intergenic
1161921987 19:7273446-7273468 CTCTTTGTACAGGTAGAAAAAGG + Intronic
1164074494 19:21801532-21801554 GACAGTGCACTGGTAGAAATTGG - Intergenic
1164829111 19:31307184-31307206 CAGTCTGCACATATAGAAACGGG - Intronic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1168233356 19:55047020-55047042 CACTCTGCAGATGAAGAAACAGG + Intronic
926503623 2:13684045-13684067 CAGTCTGCACAGAGAGAAAGAGG - Intergenic
927295434 2:21447688-21447710 AATTCTGCACATGTAAAAATGGG - Intergenic
930062744 2:47304151-47304173 CTCTCTGCAAACCTAGAAATGGG - Intergenic
930492831 2:52097689-52097711 AACTCAGAACAGGTAAAAATTGG + Intergenic
931577578 2:63735335-63735357 GAATCTGAACAGGTAGAAAGAGG + Intronic
934153582 2:89173513-89173535 CACTCAGCAAAGGGAGAAAGAGG + Intergenic
934213654 2:90008419-90008441 CACTCAGCAAAGGGAGAAAGAGG - Intergenic
936098681 2:109555247-109555269 CAATCTGGAAAGGTAGAATTAGG - Intronic
937296146 2:120811075-120811097 CACTTTGCACAGGTATGCATGGG - Intronic
939254959 2:139731045-139731067 CAAACTGCACAGCTAGAAAGTGG + Intergenic
943119905 2:183722918-183722940 AAATCCTCACAGGTAGAAATAGG + Intergenic
944207101 2:197168517-197168539 TATTCTGCACATGTAGTAATTGG - Intronic
948013339 2:234667999-234668021 CACTCTGCAGATGAAGAAATTGG - Intergenic
948394231 2:237632605-237632627 CCCTCCGCACAGGTTGATATAGG - Intronic
1168946153 20:1759920-1759942 GACTCTACAGAGGTAGAGATTGG + Intergenic
1169274707 20:4225786-4225808 CACTCTCCAGAGCTAGAAACTGG - Intronic
1169933186 20:10855975-10855997 CACTATGGACTGGTAGAAAAAGG + Intergenic
1170926195 20:20726534-20726556 AACACTGCACAGCTAGTAATGGG - Intergenic
1171571035 20:26251730-26251752 CCCCCTGCACCGGTAGAAGTCGG - Intergenic
1174344487 20:49919920-49919942 CCCTCTCAACAGGTAGAAACAGG - Intergenic
1174993284 20:55537035-55537057 CACTCTGGACAAGTGAAAATCGG + Intergenic
1178642591 21:34357088-34357110 GACTCTGCACAGGTTGAACGTGG - Intergenic
1180138874 21:45878786-45878808 TACTCAGCATAGGAAGAAATAGG + Intronic
1181362976 22:22352974-22352996 CTCACTGCACAGGTAGGAAAAGG + Intergenic
1181610218 22:24006968-24006990 CACCTTGCACAGGTAGACATTGG + Intergenic
1182360262 22:29742340-29742362 CACTCTGCAGAGGTCCAAGTGGG + Intronic
1183143833 22:35971083-35971105 CACTCTGCACAGCTTAAAAGAGG - Intronic
1184524421 22:45013381-45013403 CAAGCTGCACAGCTATAAATGGG + Intergenic
1184930935 22:47680879-47680901 CCCTCTGAACAGTTAAAAATAGG + Intergenic
949478991 3:4475330-4475352 CACCCAGCACAGGTAGTAAGGGG - Intergenic
950667421 3:14505849-14505871 CACTCAGCACAGCTGGAAATGGG - Intronic
951645167 3:24881758-24881780 CACTCTGCACAGGGAGCCTTGGG - Intergenic
952989335 3:38817995-38818017 GAATCTGCACAGCTAGAAAAGGG + Intergenic
954738312 3:52725901-52725923 AACTCTCCAAAGATAGAAATTGG + Intronic
956714993 3:72071175-72071197 CACCCTTCACATGCAGAAATTGG + Intergenic
957424061 3:80013895-80013917 CACTCAGTACAGGTAGAAATCGG + Intergenic
958644997 3:96858724-96858746 CACTGTACACAGTCAGAAATGGG + Intronic
960908495 3:122625109-122625131 CAGTTTGCTCAGCTAGAAATTGG - Intronic
962422381 3:135239966-135239988 CCCGCCGCACAGGTAGAAAGAGG + Intronic
962854254 3:139329765-139329787 CGCTCTGCAAAGGTAGTACTGGG + Intronic
963576166 3:147063069-147063091 CAGTCTGCACAGACAGAAAGAGG - Intergenic
964700396 3:159559201-159559223 AACTCTGCACAGATAGAGAAAGG + Intronic
965223175 3:165953797-165953819 CACTCTGCAAAGGAACACATGGG + Intergenic
966988615 3:185205667-185205689 CAATCTGCTCAGTGAGAAATGGG + Intronic
970631755 4:17954293-17954315 CAATGTGCACTGGTAGAAACAGG + Intronic
972808129 4:42552158-42552180 GATTTTGCACAGGTACAAATAGG - Intronic
973269039 4:48242112-48242134 CACACAGCACTGGAAGAAATTGG - Intronic
974963791 4:68735767-68735789 CACTTTGCACAGGGAGAGAAAGG + Intergenic
976440016 4:85062271-85062293 CACTTTGCAGATGAAGAAATTGG + Intergenic
977257030 4:94752819-94752841 CATTTAGCACAGGTAGAGATGGG - Intergenic
977481893 4:97589003-97589025 AACTCTGAATTGGTAGAAATGGG + Intronic
979600526 4:122582437-122582459 CAAATTGCACAGCTAGAAATTGG + Intergenic
979788106 4:124742340-124742362 CACTTTGCAAATGAAGAAATTGG - Intergenic
980381196 4:132019718-132019740 TTCTCTGCACAGGAAGGAATTGG + Intergenic
981082890 4:140652616-140652638 CAAGCTGCACAGCTAGAAAGTGG - Intronic
982101820 4:151975683-151975705 CACTGTGGGCAGGTAGAAAGGGG - Intergenic
986599470 5:9457311-9457333 CACTCTGCACAGGTAGAAATTGG - Intronic
986731018 5:10635134-10635156 CACTTTGAACAGGTGGAAAGAGG - Intronic
992837710 5:80656645-80656667 CACTCTGCTCAGGAACAAAAGGG - Intronic
995385802 5:111587348-111587370 CACTTTGCACATGTATAAATTGG + Intergenic
996209264 5:120785222-120785244 CACTTTGCAGAGTTAGAAAAAGG - Intergenic
999254384 5:150201942-150201964 CAGGCTGCACAGCTAGAAAATGG + Intronic
1000799863 5:165712578-165712600 TTCTCTGCACTGGTAAAAATGGG - Intergenic
1001187962 5:169595280-169595302 CACTCTACTGAGGTAGTAATTGG + Intronic
1006044922 6:31287231-31287253 CATGCTGCACATGAAGAAATAGG - Intronic
1006085135 6:31589840-31589862 CACTCTGCACACGTAGATGCTGG + Exonic
1006719392 6:36140288-36140310 CGAGCTGCACAGGCAGAAATGGG + Intronic
1008156307 6:48019195-48019217 CACACAGCACAGGTGGAAAGAGG + Intronic
1009064198 6:58437437-58437459 CATTCTGCAAAGGTATAATTGGG + Intergenic
1009252081 6:61315075-61315097 CACTCTGCAAAGGGATAATTGGG + Intergenic
1011899039 6:92269262-92269284 CACACTGCTCAAGTAGAAAAAGG - Intergenic
1014346204 6:120272777-120272799 CATTCTGAAAAGGGAGAAATGGG + Intergenic
1014985341 6:127999407-127999429 CACTCTGCACTGGGAAACATGGG + Intronic
1016640590 6:146344413-146344435 CACTCTGCTCAGGTTGTAAAGGG - Intronic
1020618296 7:10487664-10487686 CACACTGCATAGTTAGAAAATGG - Intergenic
1022638292 7:32158202-32158224 AACTCTGCAAAGTCAGAAATAGG - Intronic
1023345139 7:39264155-39264177 CACACAGCCCAGGTAGAAGTGGG - Intronic
1023630409 7:42158131-42158153 CACTCTGGAAAGGCATAAATGGG + Intronic
1024200636 7:47102792-47102814 CACTGTGCCCAGCCAGAAATAGG - Intergenic
1024558649 7:50625219-50625241 CACTCAGGACACATAGAAATTGG - Intronic
1026136479 7:67666478-67666500 CACTCTGAACAGGTCGATCTGGG + Intergenic
1030303102 7:107993619-107993641 CCCTCTGCAAAGGAAAAAATAGG + Intronic
1031685158 7:124724487-124724509 CACTCTACTGATGTAGAAATAGG + Intergenic
1031871888 7:127096659-127096681 CACTCTACACATGAATAAATTGG + Intronic
1039456446 8:37710645-37710667 CTCTCTGCACAGGTAGCATGGGG + Intergenic
1039846946 8:41332198-41332220 CACTGTGCCCAGGTAAAAAGTGG - Intergenic
1040837672 8:51749401-51749423 CACACTGCACAGGTGTGAATGGG - Intronic
1041207297 8:55511718-55511740 CATTCTGCACAGGTAAATAATGG + Intronic
1042495611 8:69451842-69451864 CACCATGCCCAGATAGAAATGGG - Intergenic
1042595967 8:70448527-70448549 CAATTGGCAAAGGTAGAAATTGG + Intergenic
1043968653 8:86506849-86506871 CAATCTGCTCAGTGAGAAATGGG - Intronic
1044226127 8:89720626-89720648 CACTGAGCAGAGGTAGAAACAGG - Intergenic
1044274822 8:90286675-90286697 CTCTGTGCACACATAGAAATTGG - Intergenic
1046567463 8:115919485-115919507 CACTCTCCACAGGTGGGATTAGG - Intergenic
1046969713 8:120208380-120208402 CACTCTACAAAGTTAGAAGTGGG - Intronic
1049227986 8:141466800-141466822 CACACTGCCCAGGTAGACACTGG + Intergenic
1051722036 9:20047252-20047274 CAGTCTGCATAGCTAGAAAGTGG - Intergenic
1052356583 9:27511071-27511093 CACTCTCCACAGGCAGAAGAAGG + Intronic
1054942736 9:70761163-70761185 TAATCTGTACAGGTAGAAAACGG - Intronic
1056682769 9:88733692-88733714 CACTCTGCAGAGGTTGAAGTGGG + Intergenic
1061809893 9:133156116-133156138 CACTCAGCACAGGAAGAAGGAGG + Intronic
1186042577 X:5497468-5497490 CAATTTGCACAAGTACAAATGGG - Intergenic
1188372622 X:29387341-29387363 AACTCAGCACATTTAGAAATGGG - Intronic
1192547992 X:72029270-72029292 CACCCTGCTCAAGCAGAAATGGG + Intergenic
1193162208 X:78240752-78240774 CACTCTGCCCTGGTAGGAGTGGG + Intergenic
1193463183 X:81814338-81814360 CACTCTGCTCAGTCAGAAGTTGG - Intergenic
1196602078 X:117613346-117613368 CGCTCAGCACATCTAGAAATTGG - Intergenic
1198727661 X:139693421-139693443 CACTTTCCTCAGGTATAAATTGG - Intronic
1198935578 X:141899967-141899989 CACTCTACACCAGGAGAAATAGG - Intergenic
1202091103 Y:21191378-21191400 CACAGTGCACAGAGAGAAATTGG - Intergenic