ID: 986601624

View in Genome Browser
Species Human (GRCh38)
Location 5:9478599-9478621
Sequence ATGCAAGTCCAAAACTGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1561
Summary {0: 1, 1: 0, 2: 26, 3: 307, 4: 1227}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986601624_986601628 1 Left 986601624 5:9478599-9478621 CCTTCTCAGTTTTGGACTTGCAT 0: 1
1: 0
2: 26
3: 307
4: 1227
Right 986601628 5:9478623-9478645 GGCCCTGTAGCCCTTGGTTTTGG 0: 1
1: 2
2: 29
3: 65
4: 258
986601624_986601633 19 Left 986601624 5:9478599-9478621 CCTTCTCAGTTTTGGACTTGCAT 0: 1
1: 0
2: 26
3: 307
4: 1227
Right 986601633 5:9478641-9478663 TTTGGCCAAGTTCTCCCTTTTGG No data
986601624_986601635 24 Left 986601624 5:9478599-9478621 CCTTCTCAGTTTTGGACTTGCAT 0: 1
1: 0
2: 26
3: 307
4: 1227
Right 986601635 5:9478646-9478668 CCAAGTTCTCCCTTTTGGAATGG No data
986601624_986601636 25 Left 986601624 5:9478599-9478621 CCTTCTCAGTTTTGGACTTGCAT 0: 1
1: 0
2: 26
3: 307
4: 1227
Right 986601636 5:9478647-9478669 CAAGTTCTCCCTTTTGGAATGGG 0: 3
1: 125
2: 781
3: 1257
4: 1320
986601624_986601627 -5 Left 986601624 5:9478599-9478621 CCTTCTCAGTTTTGGACTTGCAT 0: 1
1: 0
2: 26
3: 307
4: 1227
Right 986601627 5:9478617-9478639 TGCATGGGCCCTGTAGCCCTTGG 0: 1
1: 0
2: 3
3: 18
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986601624 Original CRISPR ATGCAAGTCCAAAACTGAGA AGG (reversed) Intronic
900628617 1:3621864-3621886 ATGCAAGTCCAAAATCTAGTGGG - Intergenic
900817413 1:4859090-4859112 ATACAAGTCCAAAATTCAGTAGG - Intergenic
901148247 1:7082863-7082885 ATTCAAGTGCAAAACAGACAAGG - Intronic
901335348 1:8444266-8444288 ATGCAAGTCCTAAACCCAGCAGG - Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
902084581 1:13849083-13849105 ATGCAAGTCCAAAATTCAATAGG - Intergenic
902085408 1:13856381-13856403 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
902115401 1:14116917-14116939 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
902570667 1:17345171-17345193 ATGCAAGTCCAAAATCCAGCAGG - Intronic
903645254 1:24891770-24891792 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
904427399 1:30437838-30437860 ATGCAAATCCAAAACCTAGTGGG - Intergenic
904927990 1:34063475-34063497 ATGCAAGTCCGAAATCCAGATGG + Intronic
905076777 1:35278986-35279008 AAGCAAGTTCAAAACTCAGCAGG + Intronic
905808395 1:40893741-40893763 ATGCAAGTCCAAAACCCAACAGG + Intergenic
905855566 1:41309452-41309474 AGGCATGTCCAAAACTTATAGGG + Intergenic
906017141 1:42591951-42591973 ATGCAAGTCTAAATCTCAGCAGG - Intronic
906083341 1:43108435-43108457 ATGCGAGTCCAAAACCCAGAAGG + Intergenic
906371648 1:45258850-45258872 ATGCAAGTCCAAAACCCAGCAGG - Intronic
906373008 1:45270309-45270331 ATGCAAGTCCAAAATCCAGCAGG - Intronic
906728875 1:48064286-48064308 AAGCAAAACCAAAACAGAGAAGG - Intergenic
906763914 1:48409232-48409254 ATGCAAGTCCAAAATCCAGCAGG + Intronic
906937386 1:50226091-50226113 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
907046101 1:51301111-51301133 ATGCAGGTCCAAAACACAAAAGG - Intronic
907508889 1:54943784-54943806 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
907707721 1:56847188-56847210 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
907808050 1:57841123-57841145 ATGCAAGTCCAAAACCCAACAGG + Intronic
907925739 1:58953720-58953742 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
908118617 1:60965075-60965097 ATGCAAGTCCAAAATGCAGCAGG + Intronic
908210648 1:61896322-61896344 ATGTAAGTCCAAAACCTAGTGGG - Intronic
908442569 1:64169853-64169875 ATGCAAGTCCAAAATCCAGCAGG + Intronic
908616757 1:65930619-65930641 ATGCAAGTCCAAAACCCAGCAGG - Intronic
908699386 1:66881506-66881528 ATGCAAGTCCAAAATCCAGCAGG - Intronic
908729280 1:67209047-67209069 ATGCAAGTCCAAAATCCAGCAGG - Intronic
908746750 1:67383655-67383677 ATGCAAGTCCAAAATCCAGTAGG + Intronic
908749308 1:67404290-67404312 ATGCAAGTGCCAAACACAGAAGG - Intergenic
908919334 1:69170684-69170706 ATGCAAGTCCAAAATCCAGGGGG - Intergenic
908963447 1:69729497-69729519 ATGCAAGTCCAAAATCAAGCAGG + Intronic
909057102 1:70834066-70834088 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
909058021 1:70845552-70845574 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
909096179 1:71291374-71291396 ATGCAAGTCCAAAATGCAGCAGG - Intergenic
909123974 1:71641631-71641653 CCCCAAGTTCAAAACTGAGAAGG - Intronic
909257849 1:73447755-73447777 ATGCAAGTCTGAAACTTAGCAGG + Intergenic
909265192 1:73549664-73549686 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
909439760 1:75684580-75684602 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
909579875 1:77222082-77222104 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
909718659 1:78740263-78740285 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
909794656 1:79718814-79718836 ATTCAAGTCCAAAACCCAGCAGG + Intergenic
909866954 1:80685890-80685912 ATGCAAGTCCAAAACCTGGCAGG + Intergenic
910013724 1:82496068-82496090 ATGCAAGTCTGAAACTCAGCAGG + Intergenic
910270198 1:85386407-85386429 ATGCAAGTCCAAAACTCAGTAGG + Intronic
910357495 1:86377163-86377185 ATGCAAGTCCAAAATCCAGCAGG + Intronic
910546017 1:88420211-88420233 ATGCAAATCCAAAACCCAGCAGG - Intergenic
910623802 1:89284924-89284946 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
910628980 1:89337586-89337608 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
910706833 1:90139386-90139408 ATGCACGTCCAAAATTCAGTGGG + Intergenic
911082726 1:93949690-93949712 ATGCAAGTCCAAAACCCGGCAGG + Intergenic
911235198 1:95404656-95404678 ATGCAAGTCCAAAACTTAGCAGG - Intergenic
911277409 1:95879136-95879158 ATCCAAGTCCAAAACCCAGTAGG + Intergenic
911309557 1:96276105-96276127 ATGCAAGTCCAAAATCTAGCAGG - Intergenic
911331564 1:96530736-96530758 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
911541670 1:99164519-99164541 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
911817261 1:102368790-102368812 ATGCAAGTCCAAAACCCAGCTGG - Intergenic
911840417 1:102675334-102675356 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
911969734 1:104416311-104416333 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
911982374 1:104583232-104583254 ATGCAAGTCCAAAATGCAGCAGG + Intergenic
912113408 1:106372410-106372432 ATGCAAGTCCGAAACCCAGCAGG + Intergenic
912121761 1:106479966-106479988 ATGCAAGTCCAAAATCTAGCAGG - Intergenic
912343431 1:108940834-108940856 ATGCAAGTCCATGACTGACACGG - Intronic
912736008 1:112149997-112150019 ATGCAAGTCTAAAATCCAGAGGG - Intergenic
912861087 1:113214554-113214576 ATGCAAGTTCAAAATTTAGCAGG + Intergenic
913040009 1:115012762-115012784 ATGCAAGTCTGAAACTCAGCAGG - Intergenic
913316530 1:117558501-117558523 ATGCAAGTCCAAAATCTAGCAGG + Intergenic
913345066 1:117800671-117800693 AAGCATGTCAAAAGCTGAGATGG - Intergenic
913396296 1:118376082-118376104 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
913396554 1:118378020-118378042 ATGCAAGTCCTAAACCCAGCAGG - Intergenic
913402290 1:118449355-118449377 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
913402727 1:118454422-118454444 ATGCAAGTCCAAAATTCAGCAGG + Intergenic
914857481 1:151363150-151363172 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
915465897 1:156097744-156097766 ATGCGAGCCCAACACTGATACGG + Intronic
915689652 1:157675993-157676015 ATGCAGGTCCAAAATTCAGTGGG - Intronic
915710857 1:157896826-157896848 ATGCAAGTCCAAAATCCAGCGGG + Intronic
915804282 1:158828434-158828456 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
916286277 1:163109163-163109185 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
916318832 1:163480117-163480139 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
916384907 1:164256078-164256100 ATCCAAGTCCAAAACCTAGCAGG - Intergenic
916650615 1:166831230-166831252 ATGCAAGTCCAAAATCCAGCTGG - Intergenic
916948755 1:169758078-169758100 ATGCAAGTCCAAAACCCAATAGG + Intronic
917245623 1:172997381-172997403 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
917290919 1:173471441-173471463 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
917355796 1:174125081-174125103 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
918485737 1:185026759-185026781 ATGCAAGTCCAAATCCCAGCAGG + Intergenic
918614088 1:186524262-186524284 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
918725941 1:187924083-187924105 ATGCAAGTCTAAAAATGAAAAGG - Intergenic
918727832 1:187948087-187948109 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
918993510 1:191728655-191728677 ATGCAATTCCAAAACCCAGCGGG + Intergenic
919156737 1:193775614-193775636 ATGCAAGTCTGAAACTCAGCAGG + Intergenic
919194427 1:194264653-194264675 ATGCAAGTCCAAAATCCAGTAGG - Intergenic
919291860 1:195643264-195643286 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
919376655 1:196803070-196803092 AAGCAAGTCCAAAATTCACAGGG - Intergenic
919386361 1:196927958-196927980 AAGCAAGTCCAAAATTCACAGGG - Intronic
921013758 1:211168621-211168643 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
921282269 1:213578641-213578663 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
921996514 1:221425566-221425588 ATGCAAGTCCAAAATTCAGCAGG + Intergenic
922069138 1:222174088-222174110 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
922097955 1:222458590-222458612 ATGCGAGTCCAAAACCCAGCAGG - Intergenic
922229561 1:223673968-223673990 ATGCAGGTCCAAAACCCAGCAGG + Intergenic
923172288 1:231429048-231429070 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
923197910 1:231685947-231685969 ATGCAAGTCCAAAATCCAGTGGG + Intronic
923285667 1:232492663-232492685 ATGCAAGTCCAAAACTCAGCAGG - Intronic
923339319 1:232994341-232994363 ATGCAAGTCCAACACCCAGCTGG - Intronic
923428097 1:233891964-233891986 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
923461285 1:234211580-234211602 ATGCAAGTCCAAAATCTAGCAGG - Intronic
923919259 1:238545681-238545703 ATGCAAGTCCAAAATTCAGCAGG + Intergenic
923941604 1:238833005-238833027 ATGCAAGTCTGAAACTCAGCAGG - Intergenic
924241500 1:242045297-242045319 ATGCAAGTCTGAAACCCAGAAGG - Intergenic
924504360 1:244667362-244667384 ATGCAAGTCCAAAATCCAGTGGG + Intronic
924759160 1:246968270-246968292 ATGCAAGTCCGAAACCCAGCAGG + Intronic
924767440 1:247046937-247046959 ATGCAAGTCCAAAATCCAGCAGG + Intronic
1062765176 10:57056-57078 ATGCAAGTCTGAAACCCAGAAGG + Intergenic
1064394010 10:14965972-14965994 ATACAATTCCAAGATTGAGAAGG - Intronic
1065347666 10:24764546-24764568 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1065976229 10:30845264-30845286 ATGCATGTCCAAGACTGAAAAGG - Exonic
1066040693 10:31545864-31545886 ATGCAAGTCCAAAATCCAGGGGG + Intergenic
1066041066 10:31548438-31548460 ATGCAATTCCAAAACCCAGCAGG - Intergenic
1066058679 10:31703775-31703797 TTGCAAGTCCAAAACCCAGCAGG - Intergenic
1066083567 10:31955632-31955654 TTGCAAGTCCAAAACCCAGCAGG - Intergenic
1066098735 10:32098132-32098154 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1066754782 10:38700381-38700403 AAGCAAGTTCAAAACTCAGCAGG + Intergenic
1067186681 10:44035088-44035110 AGGCATGTCAAAAGCTGAGAAGG - Intergenic
1067518233 10:46973692-46973714 ATGCAAGTCCAAAACACAGCAGG + Intronic
1067644016 10:48078136-48078158 ATGCAAGTCCAAAACACAGCAGG - Intergenic
1067783027 10:49222883-49222905 ATGTAATTCCAAAACTCAGCAGG + Intergenic
1067956349 10:50795537-50795559 ATGCAAGTCCAAAATCCAGTGGG - Intronic
1068184276 10:53564671-53564693 ATGCAAGTCCAAAATCCAGGAGG - Intergenic
1068235872 10:54231791-54231813 ATGGAAGTCCAAAACCCAGGAGG - Intronic
1068244215 10:54342858-54342880 ATGCAAGTCCACAACACAGCAGG - Intronic
1068290009 10:54989571-54989593 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1068305323 10:55200323-55200345 TTGCAAGTCCAAAACACAGCAGG - Intronic
1068368814 10:56087317-56087339 ATGCAAGGCCTAACCTGACAGGG - Intergenic
1068449267 10:57165199-57165221 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1068744211 10:60511357-60511379 ATGCGACTACAAAACTGAAAAGG + Intronic
1069106066 10:64384854-64384876 ATGCACGTCCAAAACCCAGCAGG + Intergenic
1069189361 10:65467515-65467537 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1070083107 10:73207746-73207768 ATGCAAGTTCAAAACCCAGTAGG - Intronic
1070107408 10:73447827-73447849 TTACAAGTCCAAAACTGTGTGGG + Intronic
1070224107 10:74482744-74482766 ATGCAAGTCCGAAACCCAGCAGG + Intronic
1070405276 10:76088886-76088908 AAGAAAGTCAAAGACTGAGAAGG - Intronic
1070633564 10:78106046-78106068 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1070870149 10:79744289-79744311 ATGCAAGTCCAAAATCCAGCGGG - Intergenic
1071043080 10:81337605-81337627 ATGCAATTCCTAAACTCAGCAGG - Intergenic
1071159364 10:82727959-82727981 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1071327862 10:84534628-84534650 ATGCAAGTCCAAAACCCAGTAGG - Intergenic
1071484988 10:86094043-86094065 ATGCAAGTCAATAAATGTGATGG + Intronic
1071637070 10:87266509-87266531 ATGCAAGTCCAAAATCCAGCGGG - Intergenic
1071658174 10:87471445-87471467 ATGCAAGTCCAAAATCCAGCGGG + Intergenic
1071738296 10:88326953-88326975 ATGCAAGTCTAAAACCCAGCAGG - Intronic
1071942089 10:90601380-90601402 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1071980950 10:91003969-91003991 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1072311235 10:94157423-94157445 AAGCAAGTCAACAACTGAGCTGG + Intronic
1072358317 10:94633781-94633803 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1072808278 10:98439490-98439512 ATGCAAGTCCAAAATCCAGTGGG - Intronic
1072883289 10:99249388-99249410 ATGCAAATCCAAAACACAGAAGG - Intergenic
1073841482 10:107503641-107503663 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1073952641 10:108828906-108828928 ACGCAAGTCCAAAACCCAGCAGG + Intergenic
1073979943 10:109142991-109143013 ATGAAAGTCCAAAACTCAGCAGG - Intergenic
1074242209 10:111650550-111650572 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1074495119 10:113973519-113973541 ATGAATGTCAAAAACTGTGAAGG - Intergenic
1074958937 10:118421268-118421290 ACCCAAGTCCAGAACTGCGAAGG + Intergenic
1074965912 10:118490565-118490587 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1075099245 10:119494338-119494360 TTGCAAGTCCAAAATTGACCAGG - Intergenic
1075281585 10:121143545-121143567 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1075354180 10:121756153-121756175 ATGCAAGTCCAAAATCCAGCAGG + Intronic
1075362296 10:121849345-121849367 ATGAAAATCAGAAACTGAGAAGG - Intronic
1075509202 10:123055758-123055780 ATGCAAGTCCAAAATTCAGCAGG + Exonic
1076086146 10:127634074-127634096 ATACAAGTCCAAAACCCAGAAGG + Intergenic
1077193315 11:1265352-1265374 ATGCAAGTCCAAAATCCAGCGGG + Intergenic
1077399987 11:2350186-2350208 ATACAAGTCCAAAACCCAGCAGG - Intergenic
1077525729 11:3063422-3063444 ATGCAAGTCCAAAATCCAGAGGG - Intergenic
1077740760 11:4842957-4842979 ATGCAAGTCCGAAACCCAGCAGG + Intronic
1078117289 11:8466417-8466439 ATGCAAGTCCAAAATCCAGTGGG + Intronic
1078689523 11:13565101-13565123 CTTCAGGTCCAAAACTGAGCAGG - Intergenic
1078826906 11:14938474-14938496 ATGCAAGTCCAAAACCCAGCAGG + Intronic
1079340978 11:19611584-19611606 ATGCAAGTCCAAAATCCAGTGGG + Intronic
1079656034 11:22987769-22987791 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1079686196 11:23362727-23362749 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1079713802 11:23718904-23718926 ATGCAAGTCCAAAACCCATCAGG - Intergenic
1079721862 11:23825736-23825758 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1079772042 11:24474701-24474723 ATGCAAGTCCGAAACCCAGGAGG + Intergenic
1079945268 11:26733470-26733492 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1079973079 11:27059769-27059791 ATGCAAGTCCAAAACCCAGCAGG - Intronic
1080045034 11:27799413-27799435 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1080065186 11:28002684-28002706 ATGCAAGTCCAAAATGAAGCAGG - Intergenic
1080437746 11:32261959-32261981 ATGGAAGTCCAAAACTAACAGGG + Intergenic
1080707749 11:34713790-34713812 ATGCAAGTCCAAAGCCCAGCAGG - Intergenic
1080966143 11:37217268-37217290 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1081043596 11:38242652-38242674 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1081083771 11:38774614-38774636 ATGCAATTCCAAAATCTAGAGGG + Intergenic
1081120803 11:39263103-39263125 ATGCAAGTCCAAAATACAGAAGG + Intergenic
1081157858 11:39716635-39716657 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1081270451 11:41076967-41076989 ATGCAAGTCCAAAACCAGGCCGG + Intronic
1081316478 11:41637155-41637177 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1081358544 11:42144249-42144271 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1081939509 11:46928753-46928775 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1082270770 11:50167123-50167145 ATTCAAGTCCAAAACCCAGCAGG - Intergenic
1082627828 11:55505226-55505248 ATACAAATCCAAAAGTGAGTGGG - Intergenic
1082711816 11:56561630-56561652 ATGCAAGTCCAAAATCCAGAAGG - Intergenic
1082981976 11:59132206-59132228 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1084498608 11:69520930-69520952 ATGCAAGTTCAAAACCCAGCAGG + Intergenic
1085418465 11:76335572-76335594 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1085651606 11:78273441-78273463 ATGCAAGTCCAAAATCCAGTGGG - Intronic
1085875817 11:80405085-80405107 ATGCAAGTCCAAAATCCAGTAGG - Intergenic
1086084823 11:82943764-82943786 ATGCAAGTCCAAAATTCAGTGGG + Intronic
1086503739 11:87479981-87480003 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1086558075 11:88135316-88135338 ATGCAAGTTCCAAGGTGAGAGGG + Intronic
1086840420 11:91677060-91677082 ATGCAAGTCCGAAATCCAGAGGG - Intergenic
1086954927 11:92925870-92925892 ATGCAAGTTCAAAACCCAGCAGG - Intergenic
1087255485 11:95948271-95948293 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1087474248 11:98617595-98617617 ATGCATGTCCAAAACCCAGAAGG + Intergenic
1087550141 11:99638660-99638682 ATGCAAGTCCAAAATCCAGCAGG + Intronic
1087807220 11:102568436-102568458 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1088111559 11:106267475-106267497 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1088143617 11:106648894-106648916 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1088175877 11:107052006-107052028 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1088377591 11:109159340-109159362 ATGCAAGTCCAGAATTCAGTGGG + Intergenic
1088397228 11:109382139-109382161 ATGCAAGTCCAAAACCCAGTGGG + Intergenic
1088497150 11:110442522-110442544 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1089503217 11:118945116-118945138 TGGCAAGTCCAAAAATGTGATGG - Intronic
1089746256 11:120619219-120619241 ATGCAAGTACAAAACCCAGCAGG - Intronic
1089820938 11:121225763-121225785 ATGCAAGTCTGAAACCCAGAAGG + Intergenic
1090504713 11:127298565-127298587 ATGCAAGTCTAAAACCCAGCAGG - Intergenic
1090506440 11:127320449-127320471 ATGCAAGTCCAAAATTCAGCAGG + Intergenic
1090556805 11:127885151-127885173 ATGCAAGTCCAAAATCCAGCGGG + Intergenic
1090595287 11:128314689-128314711 ATGCAAGTCCAAAACCCAGTAGG + Intergenic
1090842845 11:130507785-130507807 ATGCAAGTCCAAAAACCATAGGG - Intergenic
1092618112 12:10234117-10234139 ATGCAAGTCCAAAATCCAGTAGG + Intergenic
1093076237 12:14761346-14761368 ATGCAAATCCAAAACCCAGCGGG - Intergenic
1093136405 12:15457135-15457157 ATGCAAGTCCAAGAGTCCGAAGG - Intronic
1093350941 12:18102803-18102825 ATGCAAGTCCAAAACCCAGCAGG + Intronic
1093570782 12:20663588-20663610 ATGCAAGTCTAAAATTCAAAAGG - Intronic
1093692738 12:22125816-22125838 ATGCAAGTCCAAAATCTAGTGGG - Intronic
1093967866 12:25346030-25346052 ATTCAAATACAAACCTGAGAAGG - Intergenic
1094036904 12:26081596-26081618 ATGTAAGTCCAAAACCCAGCAGG + Intergenic
1094379793 12:29830732-29830754 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1094489179 12:30948032-30948054 ATGCAAGTCCAAAATCCAGCAGG + Intronic
1094706133 12:32915971-32915993 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1094777421 12:33746309-33746331 ATGCAAGTCCAAAACCCAGTAGG - Intergenic
1095147725 12:38750593-38750615 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1095235092 12:39785832-39785854 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1095511226 12:42953363-42953385 ATGCAAGTCCAAAATGCAGTGGG - Intergenic
1095530533 12:43181901-43181923 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1095639305 12:44468400-44468422 ATGCAAGTCCAAAACGCAGTAGG - Intergenic
1095872934 12:47050599-47050621 ATGCAAGTCCAGAACCCAGCAGG + Intergenic
1095882977 12:47158369-47158391 ATGCAAATCGAAAACTGGAAAGG - Intronic
1095922884 12:47548463-47548485 AGGCATGTCAAAACCTGAGATGG - Intergenic
1096886813 12:54726654-54726676 ACGCAAGTCTAAAACTCAGCAGG + Intergenic
1097136943 12:56864876-56864898 ATGCAAGTCCAAAATCCAGTAGG - Intergenic
1097139356 12:56886881-56886903 ATGCAAGTCCAAAACCCAGAAGG - Intergenic
1097481098 12:60126706-60126728 ATGTAGGTCCAAAATTCAGAGGG - Intergenic
1097513161 12:60568421-60568443 ATGCAAATCCAAAACCTAAAAGG - Intergenic
1097522713 12:60689043-60689065 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1097668762 12:62512426-62512448 ATGCAAGTCCGAAATTCAGCAGG + Intronic
1097757841 12:63426801-63426823 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1097955727 12:65483702-65483724 ATGCAAGTCTAAAACCCAGTGGG + Intronic
1098078464 12:66758747-66758769 ATGCAAGTCCAAAATCCAGCAGG + Intronic
1098206638 12:68117817-68117839 AGGCATGTCCAAAGCCGAGATGG - Intergenic
1098238562 12:68442629-68442651 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1098319904 12:69232574-69232596 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1098521068 12:71436095-71436117 ATCCAAGTCCAAAACCCAGCAGG + Intronic
1098741498 12:74178786-74178808 ATGCAAGTCCAAAATCCAGTAGG + Intergenic
1098743097 12:74200190-74200212 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1098939458 12:76518244-76518266 AAGCAAGTCCAAAACCCAGCAGG + Intronic
1099096252 12:78378603-78378625 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1099229227 12:80003272-80003294 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1099298336 12:80859420-80859442 ATGCAGGTCTAAAGCTCAGAGGG + Intronic
1099407519 12:82282126-82282148 ATGCAAGTCCAAAATCCAGCGGG - Intronic
1099503756 12:83446954-83446976 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1099507838 12:83500702-83500724 ATGCAAGTCCAAAATGCAGCAGG - Intergenic
1099525212 12:83710675-83710697 ATGCAAGTTCAAAACCCAGCAGG + Intergenic
1099536888 12:83856155-83856177 ATGGAAGTCCAAAATTCAGTAGG - Intergenic
1099635274 12:85204638-85204660 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1099780150 12:87183579-87183601 ATGCAAGTCCAAAATTCAGTGGG - Intergenic
1099845076 12:88018791-88018813 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1099859009 12:88205497-88205519 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1099911380 12:88838524-88838546 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1100072156 12:90734551-90734573 ATGCAAGTCCAAAACCTGGCAGG + Intergenic
1100164529 12:91901318-91901340 ATGAAAGTCCCAAACTGAGCAGG - Intergenic
1100336215 12:93632861-93632883 ATGCAAGTCCAAAACCCAGAGGG - Intergenic
1100376171 12:94018055-94018077 ATGCAAGTTCAAAACCCAGCAGG - Intergenic
1100674804 12:96855556-96855578 ATGCAAGTCCAAAATCCAAAAGG + Intronic
1100678535 12:96893917-96893939 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1100997440 12:100317408-100317430 AAGAAAGTACAGAACTGAGAGGG - Intronic
1101083834 12:101215184-101215206 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1101222687 12:102657621-102657643 ATGCAAGTCTGAAACCCAGAAGG + Intergenic
1101257888 12:102997770-102997792 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1101526324 12:105534620-105534642 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1101928117 12:108990154-108990176 ATGCAAGGTCTAAACTGAGCTGG + Intronic
1102523264 12:113492614-113492636 ATGCAGGTCCAAAATCCAGAAGG - Intergenic
1102669016 12:114601362-114601384 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1102794793 12:115679370-115679392 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1103223669 12:119267837-119267859 ATGCAAGTCCAAAAAACAGCAGG - Intergenic
1105236363 13:18557986-18558008 ATGGAAGTCCCAAAAGGAGAGGG - Intergenic
1105256599 13:18747433-18747455 ATGCAAGTCCAAACCCCAGCAGG + Intergenic
1105256681 13:18748032-18748054 ATGCAAGTCAAAAACCCAGCAGG + Intergenic
1105257023 13:18750557-18750579 ATACAAGTCCAAAACCCAGAAGG + Intergenic
1105257560 13:18754262-18754284 GTGCAAGTCCAAAACCCAGCAGG + Intergenic
1105257615 13:18754692-18754714 ATGCAAGTCAAAAACCCAGCAGG + Intergenic
1105257947 13:18757179-18757201 ATGCAAATCCAAAACCCAGCAGG + Intergenic
1105258797 13:18763491-18763513 ATGCAAGTCCAAAACCCAGGAGG + Intergenic
1105259702 13:18769931-18769953 ATACAAGTCCAAAACCCAGAAGG + Intergenic
1105260220 13:18773577-18773599 ATGCAAGTCGAAAACCCAGCAGG + Intergenic
1105260270 13:18774001-18774023 ATGCAAGTCAAAAACCCAGAAGG + Intergenic
1105260601 13:18776490-18776512 ATGCAAATCCAAAACCCAGCAGG + Intergenic
1105261466 13:18782794-18782816 ATGCAAGTCCAAAACCCAGGAGG + Intergenic
1105262380 13:18789248-18789270 ATACAAGTCCAAAACCCAGAAGG + Intergenic
1105262892 13:18792889-18792911 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1105263812 13:18799372-18799394 ATGCAAGTCCAAAACCCAGGAGG + Intergenic
1105644492 13:22302855-22302877 ATCCAAGTCCAAATCTGATAGGG + Intergenic
1106048245 13:26165697-26165719 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1106106684 13:26739083-26739105 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1106312404 13:28565271-28565293 ATGGCAGTCCAAAACTGGAAGGG - Intergenic
1106618972 13:31355786-31355808 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1106734868 13:32578468-32578490 ATGCAAGTCCAAAATTCAATAGG - Intergenic
1107039377 13:35933084-35933106 ATGCAAGTCCAAAATCCAGTGGG + Intronic
1107105292 13:36636558-36636580 ATGCAAGTCTAAAACCTAGCAGG + Intergenic
1107109449 13:36680329-36680351 ATGTAAGGCCAAAACCGACAGGG - Intronic
1107188440 13:37550314-37550336 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1108155156 13:47577005-47577027 ATGTAAGTCCAAAACTCAGCAGG + Intergenic
1108270666 13:48756380-48756402 ATGCAAGTCCAAAATACAGAAGG - Intergenic
1108603778 13:52017109-52017131 ATGCAAGTCCAAAATCCAGTGGG - Intronic
1108724252 13:53163318-53163340 ATGCAAGTCCAAAATCCAGCCGG + Intergenic
1108884038 13:55157163-55157185 ATGCAAGTCCAAAGCCCAGCAGG - Intergenic
1108930047 13:55806936-55806958 ATGCAAGTCTAAAACTCAATAGG + Intergenic
1108950692 13:56088315-56088337 AGGCAAGTCTAAAACCCAGAAGG - Intergenic
1108979434 13:56491997-56492019 ATGCAACTCCAAAACCCAGCAGG + Intergenic
1109130101 13:58574439-58574461 GTGCAAATCCAAAACCCAGAAGG + Intergenic
1109132163 13:58601208-58601230 ATACAAATCCAAACGTGAGAAGG + Intergenic
1109407257 13:61918419-61918441 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1109480342 13:62944754-62944776 ATGCCAGTCCAAAATCCAGAAGG + Intergenic
1109491122 13:63101154-63101176 ATTCAAGTCCAAAACCCAGGAGG - Intergenic
1109610799 13:64762468-64762490 ATGCAAGTCCAAAAACTAGTGGG - Intergenic
1109616280 13:64837608-64837630 TTGAAAGTCCAAAACTCAGCGGG - Intergenic
1109681358 13:65756872-65756894 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1109697415 13:65978314-65978336 ATGCAAGTACAAAACCCAGCAGG - Intergenic
1109859623 13:68179965-68179987 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1109862938 13:68224533-68224555 ATGCAAGTCCAAAATCCAGTAGG + Intergenic
1109962194 13:69645264-69645286 ATGCAGGTCCAAAACCCAGCAGG - Intergenic
1109978218 13:69870743-69870765 ATGCAAGTCCAAAATCAAGCAGG + Intronic
1109990797 13:70054317-70054339 ATTAAAGTCCAAAACAGAGATGG - Intronic
1110022375 13:70491104-70491126 ATGCAAGTCCAAAATCTAGCAGG - Intergenic
1110341879 13:74402121-74402143 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1110440630 13:75521643-75521665 ATGCAAGTCCAAAACCCATCAGG - Intergenic
1110566157 13:76959497-76959519 ATGCAAATCCAAAACCCAGCGGG + Intergenic
1110902111 13:80836847-80836869 ATGCAAATCCAAAACCCAGTAGG + Intergenic
1111051123 13:82884128-82884150 ATGCAAGTTCAAAACCCAGGAGG + Intergenic
1111053423 13:82916319-82916341 ATGCAAGTCCAAAAAATAAAGGG - Intergenic
1111065814 13:83089694-83089716 ATGCAAGTCCAAAACCTAGCAGG - Intergenic
1111081861 13:83321757-83321779 ATGCAAGTCCAAAATCAAGCAGG + Intergenic
1111189627 13:84790677-84790699 ATGCAAGTCCAAAATTCAGTGGG - Intergenic
1111207194 13:85026921-85026943 ATGGAAGTCCAAAACCCAGCAGG + Intergenic
1111246429 13:85547751-85547773 ATGCAAGTCTGAAACCAAGAAGG + Intergenic
1111318126 13:86587037-86587059 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1111385534 13:87521911-87521933 AAGCAAGACCAAAATTGAGCAGG - Intergenic
1111443009 13:88304891-88304913 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1111460965 13:88540833-88540855 AAGCAAGTCCAAAACCCAGCAGG - Intergenic
1111566889 13:90028211-90028233 ATGCAAGTCCAAAATCTAGTGGG - Intergenic
1111583964 13:90261005-90261027 ATGCAAGTCCAAAACCCAGTAGG + Intergenic
1111594189 13:90389893-90389915 ATGCAAATCCAAAACCCAGTGGG - Intergenic
1111641887 13:90979860-90979882 ATGCAAGTCCAAAACCTGGCAGG + Intergenic
1111688156 13:91527332-91527354 ATGCAAGTCCGAAACTCAGCAGG + Intronic
1112252160 13:97792438-97792460 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1112855759 13:103768030-103768052 ATGCAAGTCCAAAATCCAGTAGG + Intergenic
1112861189 13:103830934-103830956 ATGCAAGTCCAAAATTCTGTGGG + Intergenic
1112887680 13:104193987-104194009 ATGCAAGTCCAAAATCTAGCAGG - Intergenic
1112951496 13:105002852-105002874 ATGCAACACCAAAAATGAAAAGG - Intergenic
1113501795 13:110781733-110781755 ATCCAAGTCCAAAACCCAGTGGG + Intergenic
1114687497 14:24547987-24548009 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1114706946 14:24737242-24737264 GTGCAAGTCCAAAACCCAGCTGG + Intergenic
1114948479 14:27716374-27716396 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1115021348 14:28684625-28684647 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1115065616 14:29256639-29256661 ATGCAAGTCCAAAACCCAATAGG + Intergenic
1115134267 14:30090458-30090480 ATGCAAGTTCAAAACCCAGCAGG + Intronic
1115277373 14:31623150-31623172 ATGCAAGTCCAAAATCCAGTAGG - Intronic
1115481666 14:33867231-33867253 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1115820386 14:37206801-37206823 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1115916481 14:38320989-38321011 ATGCAAGTCTGAAACTCAGCAGG + Intergenic
1115919453 14:38355974-38355996 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1116154407 14:41185547-41185569 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1116165809 14:41332800-41332822 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1116364411 14:44041401-44041423 ATGTAAGTCCAAAACCTAGTAGG - Intergenic
1116387455 14:44348740-44348762 ATGCAAGTCCAAAATACAGTGGG - Intergenic
1116415458 14:44672358-44672380 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1116522852 14:45870908-45870930 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1116607165 14:47014908-47014930 ATGCATGTCAAAAGCTGAGAGGG - Intronic
1116625021 14:47253449-47253471 ATGCAAGTTCAAAATTCAGTAGG + Intronic
1116701504 14:48249739-48249761 ATGCAAGTTAAAAAGTGACAAGG - Intergenic
1116713388 14:48397530-48397552 ATGCAAGTACAAAACCCAGCAGG - Intergenic
1116783942 14:49267552-49267574 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1117749303 14:58903525-58903547 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1117758312 14:58999196-58999218 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1117984481 14:61374111-61374133 ATGCAAGTCCAAAACCCAGCAGG + Intronic
1118060752 14:62135420-62135442 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1118078653 14:62331157-62331179 ATGTGAGTACAACACTGAGAAGG + Intergenic
1118365048 14:65087546-65087568 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1118402747 14:65394717-65394739 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1119007439 14:70944381-70944403 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1119450064 14:74701891-74701913 ATGCAAGTCCAAAATCCAGCAGG + Intronic
1119862712 14:77948115-77948137 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1119934074 14:78574559-78574581 ATGCAAGTCCAAAATCCAGCGGG - Intronic
1120480819 14:85047234-85047256 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1120571037 14:86116720-86116742 ATGCAAGTCCGAAACCCAGCAGG - Intergenic
1120575392 14:86175017-86175039 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1120622000 14:86775753-86775775 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1120707607 14:87760972-87760994 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1121063375 14:90938164-90938186 ATGCAAGTCCAAAATCCAGCGGG + Intronic
1121237867 14:92406117-92406139 ATGCATGTCCAAAACTCAGTAGG + Intronic
1121318858 14:92979152-92979174 ATGCAAGTCCAAAACCCAGCAGG - Intronic
1121499130 14:94419604-94419626 ATGCAAGTCCAAAATCCAGGGGG - Intergenic
1121672650 14:95724527-95724549 ATGCAAGTCCAAAACCCAACAGG - Intergenic
1121881958 14:97508635-97508657 ATGCAAATCCAAAATTTAGCAGG - Intergenic
1121914208 14:97821101-97821123 ATGCAAGTACAAAACTCATCGGG - Intergenic
1122831977 14:104402705-104402727 ATGCAAGTCCAAAACGCAGCAGG - Intergenic
1123197414 14:106629754-106629776 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1123198752 14:106641630-106641652 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1202835372 14_GL000009v2_random:74237-74259 ATGCAAGTCAAAAACCCAGCAGG - Intergenic
1202835433 14_GL000009v2_random:74670-74692 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1124001175 15:25761661-25761683 ATGCAAGTCCAAAATCCATAGGG - Intronic
1124226332 15:27897964-27897986 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1124508991 15:30306410-30306432 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1124556007 15:30726675-30726697 ATGCAAGTCCAAAATCCAGTAGG + Intronic
1124675267 15:31679096-31679118 ATGCAAGTCCAAAATCCAGTAGG - Intronic
1124734566 15:32232252-32232274 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1125177587 15:36842412-36842434 CTGCAATTCCAAACCTGAAATGG - Intergenic
1125233361 15:37483605-37483627 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1125806518 15:42497914-42497936 ATGCAAGTCCAAAATCCAGTGGG + Intronic
1125881461 15:43199390-43199412 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1126189457 15:45864652-45864674 ATGAAAGTGCAAAAATGAAAGGG - Intergenic
1126203916 15:46020364-46020386 ATCCAAGTCCAAAACCCAGCAGG - Intergenic
1126469315 15:48990772-48990794 AAGCAGGCACAAAACTGAGAAGG - Exonic
1126815340 15:52448303-52448325 ATGCAAGTACAAAACCCAGCAGG - Intronic
1126932625 15:53671852-53671874 ATGCTAGTCTAAAGATGAGATGG + Intronic
1127955278 15:63847669-63847691 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1128683299 15:69666739-69666761 ATGCAAGGCCAGAAGTGAGGAGG + Intergenic
1128688764 15:69707319-69707341 ATGCAAGTCCAAAATACAGCAGG + Intergenic
1128718550 15:69928471-69928493 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1128814063 15:70592784-70592806 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1129178248 15:73855412-73855434 AAGGAAGTCCAAAAGTGACAGGG + Intergenic
1129469532 15:75743116-75743138 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1129812698 15:78523797-78523819 ATGCAAGTCCAAAACCCAGCAGG + Intronic
1130324243 15:82866265-82866287 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1130416989 15:83703100-83703122 ATGCAAGTCCAAAATCTAGTGGG - Intronic
1130439225 15:83934312-83934334 ATGCAAGTCGAAAATTTAGCTGG - Intronic
1130778482 15:87009800-87009822 ATGCAAGTCCAAAATCCAGTGGG - Intronic
1131410280 15:92201568-92201590 ATGCAAGTCTGAAACCCAGAAGG - Intergenic
1131427104 15:92354600-92354622 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1131659598 15:94499357-94499379 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1131803429 15:96096449-96096471 ATGCAAAAGCAAAACAGAGAAGG - Intergenic
1131987523 15:98060221-98060243 ATGTAAGTCCAAAACCCAGCAGG + Intergenic
1133364351 16:5198838-5198860 ATGCAAGAATAAAACAGAGAAGG + Intergenic
1135275948 16:21112857-21112879 ATGCAAGTCCAAAATCCAGTGGG - Intronic
1136674713 16:31892686-31892708 ATGCAAGTCCAAAATCCAGCAGG + Intronic
1137778575 16:51077387-51077409 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1138769625 16:59648354-59648376 ATGCAAGTCCAAAATCTAAAGGG + Intergenic
1138895507 16:61199181-61199203 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1140592534 16:76370781-76370803 ATGCAATTTCAAAACTGAAAGGG - Intronic
1142909819 17:3079555-3079577 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1142924683 17:3224254-3224276 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1143250730 17:5521355-5521377 AGACCAGTCCAAGACTGAGAGGG + Intronic
1144351706 17:14403124-14403146 ATGCAAGTCCAAAACCTGGCAGG - Intergenic
1144508858 17:15857663-15857685 AGGCAAGTCCAAAACCCAGTGGG - Intergenic
1145172973 17:20675303-20675325 AGGCAAGTCCAAAACCCAGTGGG - Intergenic
1146391856 17:32430151-32430173 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1146451858 17:32981154-32981176 ATGCAAGTCCAAAATCCAGTTGG + Intronic
1146452674 17:32987166-32987188 ATGCAAGTCCAAAACCCAGCTGG + Intronic
1146502276 17:33374304-33374326 ATGCAAGTCTAAAAATCAAAAGG - Intronic
1146568825 17:33936043-33936065 ATGCAAGTCCCTAACCCAGAAGG + Intronic
1147593257 17:41699446-41699468 ATGCAGATCTAAAACTGCGATGG + Intergenic
1147769366 17:42856939-42856961 CTGCAAGTCCATAGCTGAGCTGG + Exonic
1148288860 17:46422990-46423012 AAGCAAGGCCAAAAGTGAGGGGG - Intergenic
1148311029 17:46640567-46640589 AAGCAAGGCCAAAAGTGAGGGGG - Intronic
1148762517 17:50014267-50014289 ATGCAAGTCTGAAACCCAGAGGG + Intergenic
1149081926 17:52667953-52667975 AGGCAAGTCCAAAACCCAGCTGG + Intergenic
1149101293 17:52909715-52909737 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1149175662 17:53867534-53867556 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1149341181 17:55687847-55687869 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1149386265 17:56146079-56146101 ATGCAAGTCCAAAATCCAGTGGG + Intronic
1150449077 17:65250773-65250795 ATGTAAGTCCAGAGCTCAGAGGG + Intergenic
1151106211 17:71619505-71619527 ATGCAAGTCCAAAATCCAGCGGG - Intergenic
1152967390 18:129578-129600 ATGCAAGTCCAAAATACAGTGGG + Intergenic
1153011874 18:546918-546940 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1154424556 18:14262015-14262037 ATGCAAGTCCAAAACCCAGGAGG - Intergenic
1154425023 18:14265419-14265441 ATCCGAGTCCAAAACTCAGCAGG - Intergenic
1154425413 18:14268306-14268328 ATGCAAGTCCATAACCCAGCAGG - Intergenic
1154426326 18:14274881-14274903 ATACAACTCCAAAACCCAGAAGG - Intergenic
1154427243 18:14281365-14281387 ATGCAAGTCCAAAACCCAGGAGG - Intergenic
1154428064 18:14287297-14287319 ATGCAAGTCAAAAACCCAGCAGG - Intergenic
1154428555 18:14290821-14290843 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1154429964 18:14300900-14300922 ATGCAAGTCCAAAACCCAGGAGG - Intergenic
1154431339 18:14310810-14310832 ATACAAGTCCGAAACCCAGAAGG - Intergenic
1154432251 18:14317242-14317264 ATGCAAGTCCAAAACCCAGGAGG - Intergenic
1154432711 18:14320645-14320667 ATGCGAGTCCAAAACCCAGCAGG - Intergenic
1154433500 18:14326469-14326491 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1154434017 18:14330116-14330138 ATACAAGTCCGAAACCCAGAAGG - Intergenic
1154434367 18:14332646-14332668 ATGCAAGTCAAAAACCCAGCAGG - Intergenic
1154504311 18:15020507-15020529 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1154513177 18:15131982-15132004 ATGGAAGTCCCAAAGGGAGAGGG + Intergenic
1154926599 18:20942481-20942503 ATGCAAGTCCAAAATACAGTGGG - Intergenic
1155745890 18:29356099-29356121 ATGCAAGTCCAAAACCCAGCTGG - Intergenic
1155773402 18:29727617-29727639 ATGCAAGTTCAAAACCCAGCAGG - Intergenic
1156082048 18:33347876-33347898 ATGAAACTGCAAAACTGAGATGG - Intronic
1156322413 18:36038832-36038854 ATGCAAGTCCGAAACCCAGCAGG - Intronic
1156683253 18:39616605-39616627 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1156941063 18:42767377-42767399 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1157611238 18:48957388-48957410 GTGCAAGTCCTAACCTGGGATGG + Intergenic
1157911907 18:51624330-51624352 TTGCAATTCCAAGGCTGAGATGG + Intergenic
1158101590 18:53835308-53835330 CTGCAAGTCCAAAACCCAGCAGG - Intergenic
1158797058 18:60859102-60859124 ATGCAAGAACAAAACAGACATGG + Intergenic
1159319576 18:66830017-66830039 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1159606343 18:70478726-70478748 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1159617606 18:70599155-70599177 ATGCAAGTCCAAAATCTAGCAGG - Intergenic
1159705156 18:71677074-71677096 ATGCAAGTCCAAAATCAAGCAGG + Intergenic
1159718725 18:71858722-71858744 ATGCAAGTCCAAAATCCAGTAGG + Intergenic
1160573807 18:79837168-79837190 ATGCAAATCCAAAACCCAGCAGG + Intergenic
1164036546 19:21460762-21460784 ATGCAACTCCAAAACCCAGAAGG + Intronic
1164447462 19:28330206-28330228 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1164514454 19:28921992-28922014 AAGCAAGTCCAAAACCCAGCAGG - Intergenic
1164666577 19:30042810-30042832 ATGCAAGTCCAAAATCTAGTGGG - Intergenic
1165248169 19:34509833-34509855 ATGCAAGTCCAAAATCCAGCGGG + Exonic
1165888315 19:39095374-39095396 ATGCAAGTCCAAAATCCAGCAGG + Intronic
1166263805 19:41663771-41663793 ATGCAAGTCCAAAATCCAGGGGG + Intronic
1166594322 19:44031818-44031840 AGGCAAGATCCAAACTGAGATGG + Exonic
1167403555 19:49289044-49289066 ATGCAAGTCCAAAATCTAGCAGG - Intergenic
1167829940 19:52011331-52011353 ATGCAAGTTCAAAACCCAGCAGG - Intergenic
1168496289 19:56854299-56854321 ATGCAAGTCCAAAATCCAGCTGG - Intergenic
1168516477 19:57013629-57013651 ATGCAAATCCAAAACCCAGTAGG - Intergenic
1202637252 1_KI270706v1_random:53112-53134 ATGCAAGTCAAAAACCCAGCAGG + Intergenic
925036021 2:686468-686490 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
925257032 2:2499146-2499168 TTGCAAGTCCAAAACGCAGGGGG + Intergenic
925393205 2:3513042-3513064 ATGAAAGTTCAAAACTCAGCAGG - Intronic
925453274 2:3990246-3990268 ATGCAAGTCCAAAATCTAGCAGG + Intergenic
925494783 2:4435025-4435047 ATGCAAGTCCAAAACCTGGCAGG + Intergenic
925539526 2:4951925-4951947 ATGCAAGTTCAAAACCCAGCAGG + Intergenic
925594835 2:5544766-5544788 CTGCAAGTCCAAAACCCAGCAGG - Intergenic
926099498 2:10105309-10105331 ATGCAAGTCCAAACCCCAGCAGG + Intergenic
926483891 2:13431990-13432012 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
926597773 2:14809954-14809976 ATGCAAGTCCAAAATACAGCGGG - Intergenic
926785363 2:16512538-16512560 ATGTAAGTCCAAACTTAAGATGG + Intergenic
926816634 2:16804409-16804431 ATGCAAGTCCAAAATCCAGAAGG + Intergenic
926836642 2:17031085-17031107 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
926871014 2:17417246-17417268 AAGCAAGTCCAAAACCTGGAAGG + Intergenic
926929537 2:18023370-18023392 ATGCAAGTCCAAAATCCAGCAGG + Intronic
926984902 2:18612034-18612056 CTGAGAGTCCAAAAGTGAGAAGG + Intergenic
927341835 2:21991925-21991947 ATGCAAGTCTAAAATTCAAAGGG + Intergenic
928749973 2:34459513-34459535 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
929060464 2:37919076-37919098 AAGGAAGTCCTAAAATGAGAGGG + Intergenic
929081682 2:38128051-38128073 ATGCAAGTCCGAAACCCAGCAGG - Intergenic
929226994 2:39521393-39521415 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
929260793 2:39864435-39864457 ATGCAAGTCCAAAATCCAGTAGG - Intergenic
929376087 2:41288772-41288794 ATGCAAGTCAAAAATTCAGAGGG + Intergenic
929612904 2:43284932-43284954 ATGCAAGTTCAAAACCCAGCAGG - Intronic
930227753 2:48811917-48811939 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
930521377 2:52471287-52471309 ATGCAAGTCCGAAACTAAATAGG - Intergenic
930523585 2:52498071-52498093 ATGCAAGTTCAAAACCCAGCAGG - Intergenic
930558420 2:52929425-52929447 ACGCAAGTCCAAAACTGATCAGG + Intergenic
930585530 2:53263255-53263277 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
931033430 2:58210771-58210793 ATGCAAGTCCAAAATCCAGCAGG + Intronic
931041503 2:58305672-58305694 ATGCAAGTCCAAAATTCAGTGGG - Intergenic
931096188 2:58943365-58943387 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
931159944 2:59678026-59678048 ATGCAGGGCCTAAAGTGAGACGG + Intergenic
931439550 2:62278508-62278530 ATGCAAGTCCAAAACCTAGCAGG - Intergenic
932317945 2:70798627-70798649 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
932552412 2:72785065-72785087 ATGCAAGTCCAAAATCCAGGGGG + Intronic
932821556 2:74906008-74906030 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
932927097 2:75989291-75989313 ATGCAAGTCCAAAATCCAGGGGG + Intergenic
933070969 2:77857554-77857576 ATGTAAGTCCAAAACACAGCTGG - Intergenic
933099007 2:78226497-78226519 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
933305439 2:80591907-80591929 ATGGAAGTCAAGAACTGAGTGGG - Intronic
933350315 2:81145428-81145450 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
933481990 2:82869660-82869682 ATGCCAGTCCAAAACCCAGAAGG + Intergenic
933508045 2:83203852-83203874 ATGCAAGTCCAAAATCCAGTTGG + Intergenic
933521637 2:83381487-83381509 ATGCAATTCCAAAACCCAGCAGG - Intergenic
933584884 2:84169370-84169392 ATGCAAGTCCAAAATCCAAATGG - Intergenic
933798628 2:85942119-85942141 ATGAAAGTCCAAAATCCAGAGGG + Intergenic
933864080 2:86500185-86500207 ATGCAAGTCCAAAATCCAGGAGG + Intergenic
933985892 2:87591865-87591887 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
934055060 2:88244438-88244460 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
934318067 2:91944616-91944638 AAGCAAGTTCAAAACTCAGCAGG + Intergenic
934491653 2:94765265-94765287 AGGCAAGTCCAAAACCCAGCAGG + Intergenic
934492080 2:94768389-94768411 ATGCAAGTCCAAAACCCAGGAGG + Intergenic
934492676 2:94772384-94772406 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
934493092 2:94775518-94775540 ATGCGAGTCCAAAACCCAGCAGG + Intergenic
934493154 2:94776029-94776051 ATGCAAGTCAAAAACCCAGCAGG + Intergenic
934700920 2:96439399-96439421 ATGCAAGTCCAAAATCTAGCAGG - Intergenic
935239813 2:101168657-101168679 ATGCAAGTTCAAAACCCAGGAGG - Intronic
935385141 2:102491973-102491995 ATGCAAGTCCAAAATCCAGAAGG + Intronic
935481509 2:103595291-103595313 ATGCAAGTCCAAAATCCAGCTGG - Intergenic
935931601 2:108132929-108132951 ATGCAAGTCTAAAACCTAGCAGG + Intergenic
935940466 2:108232838-108232860 ATGCAAGTCCAAAATTCAGCAGG - Intergenic
936161869 2:110089497-110089519 ATGCAAGTCCTAAACCCAGCTGG - Intronic
936169449 2:110155657-110155679 ATGCAAGTCCAAAATCCAGCTGG - Intronic
936182794 2:110281857-110281879 ATGCAAGTCCTAAACCCAGCTGG + Intergenic
936307947 2:111358939-111358961 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
936526174 2:113242983-113243005 ACTCAAGGCCAAAACAGAGATGG + Intronic
936734695 2:115427028-115427050 ATGCAAGTTCAAAACACAGCAGG + Intronic
936788717 2:116125140-116125162 ATGCAAGTCCAAAACCTAGCAGG + Intergenic
936862304 2:117032435-117032457 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
936872060 2:117145550-117145572 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
936898400 2:117455228-117455250 ATGCAAGTTCAAAACCCAGCAGG - Intergenic
936915791 2:117637939-117637961 ATGCAAGTCCAAAATCCAGCGGG - Intergenic
936969705 2:118165208-118165230 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
937117700 2:119420462-119420484 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
937427730 2:121813910-121813932 ATGCAATTCCAAAACCCAGCAGG - Intergenic
937491317 2:122371273-122371295 ATGCAAGTCCAAAACACAGCAGG + Intergenic
937640166 2:124203178-124203200 ATGCAAGTCCAAAATCCAGCAGG + Intronic
937828043 2:126389139-126389161 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
937995346 2:127690265-127690287 ATGCAAGTTCAAAACCCAGCAGG + Intergenic
938165451 2:129021734-129021756 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
938330905 2:130447483-130447505 ATGCACGTCCAAAACCCAGCAGG + Intergenic
938503501 2:131850713-131850735 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
938510347 2:131936174-131936196 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
939125456 2:138172474-138172496 ATACAAGTCCAAAACCCAGAAGG - Intergenic
939498213 2:142949035-142949057 ATGCAAGTCCAAAATCCAGTGGG + Intronic
939559208 2:143713737-143713759 ATGCAAGTCCAAAATCCAGTGGG + Intronic
939644662 2:144682784-144682806 CTGCAAGTACAGCACTGAGAAGG - Intergenic
939667479 2:144969132-144969154 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
939752350 2:146063646-146063668 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
940355569 2:152738098-152738120 ATGCAAGTCCGAAATTCAGTAGG + Intronic
940359909 2:152786363-152786385 ATGCAAGTCCAAAATTGAACAGG + Intergenic
940425890 2:153531816-153531838 ATGCAAGTCCGAAACCCAGCAGG + Intergenic
940444875 2:153765402-153765424 ATGCAAGTCCAAAACCCAATAGG - Intergenic
941247177 2:163113161-163113183 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
941335606 2:164240395-164240417 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
941468849 2:165860391-165860413 ATGCAAGTCCAAAATCCAGCAGG + Intronic
941803523 2:169687492-169687514 ATGCAAGTCCAAAATCCAGCAGG + Intronic
942118098 2:172748915-172748937 ATGCAAGTCCAAAATCCAGTGGG + Intronic
942281035 2:174364179-174364201 ATGCAAGTCCAAAATCCAGCAGG + Intronic
942319534 2:174724479-174724501 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
942367015 2:175238797-175238819 ATGCAAGTCCAAAATCTAGCAGG + Intergenic
942420040 2:175797834-175797856 ATGCAAGTCCAAAAGCCAGCAGG - Intergenic
942727593 2:179026882-179026904 ATGCAAGTCCAAAATCCAGCAGG - Intronic
942981812 2:182092701-182092723 ATGCAAGTCCAAAATCCAGCAGG + Intronic
943072117 2:183153517-183153539 ATGCAAGTTCAAAATCCAGAGGG + Intronic
943193893 2:184718622-184718644 ATGCAAGTCCAAAATCCAGTGGG + Intronic
943238106 2:185348175-185348197 ATGCAAGTTCAAAATGCAGAAGG - Intergenic
943415017 2:187591036-187591058 ATGCAAATCCAAAACCCAGCAGG + Intergenic
943417862 2:187630893-187630915 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
943427296 2:187752408-187752430 ATGCAAATCCAAAATCCAGAGGG + Intergenic
943484030 2:188456964-188456986 ATGCAAGTCCAAAATCCAGTGGG - Intronic
943557913 2:189427861-189427883 ATGCAAGTCTGAAACTCAGCAGG - Intergenic
943565416 2:189510335-189510357 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
943889682 2:193271121-193271143 AAGCAAGTCCAAAACATAGCAGG + Intergenic
944470246 2:200045464-200045486 ATGCAAGTCCAAAGCCCAGCAGG + Intergenic
944491598 2:200263299-200263321 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
944800244 2:203231647-203231669 ATGCAAGTCCAAAATCCAGAGGG - Intergenic
944943008 2:204651371-204651393 ATGCAAGTCCAAAACCCAGCAGG + Intronic
945109494 2:206348955-206348977 ATGCAAGTCCAAAAGCCAGTGGG + Intergenic
945114178 2:206394484-206394506 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
945120734 2:206454749-206454771 ATGCAAGTCCGAAACCTAGCAGG + Intronic
945157274 2:206852814-206852836 ATACAAGTTCATAACTGAGATGG + Intergenic
945356361 2:208843898-208843920 ATTCAAGTCCAAAACGCAGCAGG - Intronic
945410175 2:209498188-209498210 ATGCAAGTTCAAAACCTAGCAGG + Intronic
945416900 2:209585102-209585124 ATGCAGATCCAAAGCTGAGAAGG + Intronic
945540178 2:211075698-211075720 TTTCAAGTCCAATATTGAGAAGG - Intergenic
945618770 2:212107344-212107366 ATGCAAGTCCAAAATCCAGCAGG - Intronic
946528698 2:220548274-220548296 ATGCAAGGCCAACTCTGAAAAGG + Intergenic
946534055 2:220607514-220607536 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
946930009 2:224661967-224661989 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
946937506 2:224737000-224737022 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
946995361 2:225384668-225384690 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
947008373 2:225537947-225537969 ATGCAAGTCCAAAATCCAGTGGG + Intronic
947443248 2:230141538-230141560 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
947900285 2:233716113-233716135 ATGGAATTCCAAAACTAAGATGG - Intronic
947903172 2:233739561-233739583 ATGCAAGTCCAAAACCAGGCAGG - Intronic
947904585 2:233751226-233751248 ATGCAAGTCCAAAACCAGGCAGG - Intronic
1169067188 20:2700758-2700780 ATGCAAGTTCCAAAGAGAGAGGG - Intronic
1169164975 20:3415302-3415324 ATGCAAGTCTGAAACCCAGAAGG + Intergenic
1169676271 20:8158766-8158788 ATGCAAGTCCAAAATCTAGCAGG + Intronic
1170079076 20:12451200-12451222 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1170174326 20:13451822-13451844 AGGCATGTCAAAAGCTGAGATGG - Intronic
1170260396 20:14399400-14399422 ATGCAAGCCAAAAACAGTGAAGG - Intronic
1171076983 20:22137522-22137544 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1171149370 20:22813577-22813599 ATGCAAGTCAAAAACGACGAAGG + Intergenic
1171883354 20:30633702-30633724 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1171883416 20:30634136-30634158 ATGCAAGTCAAAAACCCAGCAGG + Intergenic
1171883750 20:30636625-30636647 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1171884645 20:30643109-30643131 ATGCAGGTCCAAAACCCAGGAGG + Intergenic
1172720320 20:36995016-36995038 ATGCAAGTCTGAAATTGAGTGGG - Intergenic
1173185431 20:40836628-40836650 ATGACAGTACAAAAGTGAGAAGG - Intergenic
1173243223 20:41316813-41316835 ATGAAAATCCCAAACTGGGAAGG + Intronic
1175008577 20:55711284-55711306 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1175556081 20:59857952-59857974 ATGCAAGTCCCAAACCCAGGAGG - Intergenic
1175806945 20:61834752-61834774 AGCCAAGTCCAAAGCCGAGACGG - Intronic
1176315378 21:5237604-5237626 ATGCAAGTCCAAAATTCAATGGG - Intergenic
1176346705 21:5755047-5755069 ATGCACGACCAGACCTGAGACGG + Intergenic
1176353519 21:5875631-5875653 ATGCACGACCAGACCTGAGACGG + Intergenic
1176498122 21:7569408-7569430 ATGCACGACCAGACCTGAGACGG - Intergenic
1176541026 21:8153117-8153139 ATGCACGACCAGACCTGAGACGG + Intergenic
1176559977 21:8336162-8336184 ATGCACGACCAGACCTGAGACGG + Intergenic
1176657638 21:9602181-9602203 ATGCAAGTCCAAAATGCAGCAGG + Intergenic
1176780356 21:13186271-13186293 ATGGAAGTCCCAAAAGGAGAGGG - Intergenic
1176783481 21:13227152-13227174 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1176842592 21:13852461-13852483 ATGCAAGTCCAAACCCCAGCAGG + Intergenic
1176842673 21:13853072-13853094 ATGCAAGTCAAAAACCCAGCAGG + Intergenic
1176843010 21:13855607-13855629 ATACAAGTCCAAAACCCAGAAGG + Intergenic
1176843543 21:13859282-13859304 GTGCAAGTCCAAAACCCAGCAGG + Intergenic
1176843601 21:13859716-13859738 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1176843936 21:13862208-13862230 ATGCAAGTCCAAAACCCAGCGGG + Intergenic
1176844788 21:13868511-13868533 ATGCAAGTCCAAAACCCAGGAGG + Intergenic
1176845704 21:13874953-13874975 ATACAAGTCCAAAACCCAGAAGG + Intergenic
1176846218 21:13878601-13878623 ATGCAAGTCCAACACCCAGCAGG + Intergenic
1176846624 21:13881529-13881551 ATGCAAGTCCAAAACCCAGCGGG + Intergenic
1176846701 21:13882126-13882148 ATGCAAGTCAAAAACCCAGCAGG + Intergenic
1176848094 21:13891976-13891998 ATGCAAGTCAAAAACCCAGCAGG + Intergenic
1176848950 21:13898143-13898165 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1177026260 21:15925180-15925202 ATGCAAGTCCAAAATTCAGCGGG + Intergenic
1177130506 21:17248889-17248911 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1177163745 21:17576876-17576898 AGTCAAGTGCAAAAGTGAGAAGG - Intronic
1177212106 21:18083695-18083717 ATGCAAGTCCAAAGCCCAGCAGG - Intronic
1177339697 21:19783476-19783498 ATGCAAGTCCAAAATCCAGGAGG + Intergenic
1177367143 21:20153189-20153211 ATGCAAGTCTGAAACTCAGTGGG + Intergenic
1177402377 21:20623000-20623022 ATGCAAGTCCAAAACTCAAAAGG + Intergenic
1177471213 21:21563324-21563346 ATGCAAGTCCAAAATCTAGCAGG + Intergenic
1177473163 21:21584529-21584551 ATGCAAGTCCAAAATCCAGTAGG - Intergenic
1177594062 21:23212781-23212803 ATACAAGTCCAAAACCTAGCTGG + Intergenic
1177602750 21:23336589-23336611 ATGCAAGTCCGAAACCCAGCAGG - Intergenic
1177606096 21:23379384-23379406 ATGCAAGTCCAAAATCCAGTAGG - Intergenic
1177649122 21:23937950-23937972 TTGCAAGTCCAAAATTCACAGGG + Intergenic
1177684464 21:24418591-24418613 ACGCAAGTCCAAAATCGAGCAGG + Intergenic
1177686794 21:24447571-24447593 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1177741201 21:25155335-25155357 ATGCAAGTCCAAAATCCAGGGGG - Intergenic
1177765180 21:25449781-25449803 ATGCATGTCCAAAACTCAGCAGG + Intergenic
1177978031 21:27875290-27875312 ATGGAAGTCCCAAAAGGAGAGGG - Intergenic
1178468954 21:32874756-32874778 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1179508637 21:41858122-41858144 ATGGAAGTCCCAAACAGAAAGGG + Intronic
1179936757 21:44610902-44610924 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1179944510 21:44662483-44662505 ATGCAACAAAAAAACTGAGAAGG + Intronic
1180332813 22:11547939-11547961 ATGAAAGTCTAAAACCCAGAAGG - Intergenic
1180393162 22:12303559-12303581 ATGCAAGTCCAAAATTCAATGGG - Intergenic
1180406587 22:12561209-12561231 ATGCAAGTCCAAAATTCAATGGG + Intergenic
1181448566 22:23000326-23000348 ATGCCAGTCCAAAACCCAGCAGG + Intergenic
1181812626 22:25413250-25413272 AAGCAAGTCCAAAACCCAGCCGG + Intergenic
1203245966 22_KI270733v1_random:69536-69558 ATGCACGACCAGACCTGAGACGG + Intergenic
949407790 3:3732951-3732973 ATGCAAATCAATAAATGAGAAGG - Intronic
949692310 3:6654503-6654525 ATGCAAGTCCCAAAATTAGCAGG + Intergenic
949693597 3:6668173-6668195 ATGCAAGTTCAAAACCCAGCAGG - Intergenic
949770282 3:7570457-7570479 ATGCAAGTCCAAAATCCAGCAGG + Intronic
949803649 3:7931187-7931209 ATGCAAATACCAAACTGAAAGGG - Intergenic
951100704 3:18684690-18684712 ATGCAAGTCCAAAACCCAGCTGG - Intergenic
951378126 3:21948678-21948700 ATGCAATTGGAAAACAGAGAAGG - Intronic
951756386 3:26096005-26096027 ATGCAAGTCCAAAATTCAATGGG + Intergenic
951801664 3:26603314-26603336 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
952139228 3:30459573-30459595 ATGCAAGTTCAAAACCCAGCAGG - Intergenic
952185160 3:30960751-30960773 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
952247169 3:31607013-31607035 ATGCAAGTCCAAAATCCAGCAGG - Intronic
952397164 3:32930995-32931017 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
952401288 3:32966363-32966385 ATGCAAGTCCAAAACCCAATAGG - Intergenic
952569845 3:34701422-34701444 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
952605819 3:35145828-35145850 ATGCAAGTCCAAAATTCAGTGGG + Intergenic
952612077 3:35223794-35223816 AAGCAAGGCCAACTCTGAGAGGG + Intergenic
952715000 3:36471657-36471679 ATGCAAGTCCAAAATTCAGTGGG + Intronic
952831332 3:37567696-37567718 ATGCAAGTCCAAAACCCAGCGGG + Intronic
953198238 3:40754008-40754030 ATGCAAGTTAAAAGGTGAGAAGG + Intergenic
953202242 3:40787827-40787849 ATACAAGTCCGAAACTCAGCAGG - Intergenic
953503838 3:43463547-43463569 ATGCAAGTCCAAAATCCAGCAGG - Intronic
953624759 3:44561710-44561732 ATGCAAGTCCAAAACCAAGCAGG + Intronic
954591645 3:51788361-51788383 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
955191303 3:56764230-56764252 GTGCAAGTCCAAAATTAGGAAGG + Intronic
955395372 3:58553600-58553622 ATGCAAATCCAAAACCCAGCAGG + Intergenic
955435405 3:58894423-58894445 ATGCAAGTCCAAAATCCAGCAGG + Intronic
955826379 3:62951868-62951890 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
955833167 3:63026235-63026257 GTGCAAGTCCAAAACCCAGCAGG + Intergenic
956169463 3:66421460-66421482 ATGCAAGTCCAAAATCCAGCGGG + Intronic
956282182 3:67569572-67569594 AAGCAAGTCCAAAACCTAGCAGG - Intronic
956391705 3:68780081-68780103 ATGCAAGTCCTAAATTCAGTGGG - Intronic
956489268 3:69753719-69753741 ATGCAAGTCCAAAACCCAGCAGG - Intronic
956911463 3:73822042-73822064 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
957113245 3:75992890-75992912 ATGCAAGTCCAAAATCCAGCAGG - Intronic
957144987 3:76412602-76412624 ATGCAAGTCCAAAATCTAGCAGG + Intronic
957474353 3:80704849-80704871 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
957572921 3:81971191-81971213 AGGCATGCCAAAAACTGAGATGG + Intergenic
957609944 3:82453343-82453365 ATGCAAGTCCAAAACCAGGCAGG - Intergenic
957625281 3:82647060-82647082 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
957674367 3:83347371-83347393 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
957870247 3:86082756-86082778 ATGCAAGTCCAAAATCCAGTTGG + Intergenic
957870804 3:86088958-86088980 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
957896250 3:86424494-86424516 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
957909924 3:86607633-86607655 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
957929827 3:86863462-86863484 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
958157248 3:89770985-89771007 GTGCAAGTCCAAAATTGAGTGGG + Intergenic
958175373 3:89989971-89989993 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
958475023 3:94569410-94569432 ATGCAAGTCCAAAACCTAACAGG - Intergenic
958537632 3:95424940-95424962 ATGCAAATCCAAAACCCAGTGGG + Intergenic
958560427 3:95742357-95742379 ATGCGAGTCCAAAACCCAGCAGG + Intergenic
958588233 3:96118534-96118556 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
958611815 3:96436310-96436332 ATGCAAGTCCAAAATCAAGCAGG + Intergenic
958841348 3:99209287-99209309 ATGCAAGTTCAAAACCCAGCAGG + Intergenic
958893376 3:99804713-99804735 ATGCAAGTCTGAAACTCAGTAGG + Intergenic
958955083 3:100458370-100458392 ATACAAGTCCAAAATTCAGTGGG + Intergenic
959104683 3:102052158-102052180 ATGCAAGTCCAAAATCCAGCTGG - Intergenic
959141094 3:102487372-102487394 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
959183124 3:103007511-103007533 ATGGAAGTCCAAAACTCAGCAGG + Intergenic
959233577 3:103690113-103690135 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
959507995 3:107176678-107176700 ATGCAAGTCCAAAACCCAACAGG - Intergenic
959777703 3:110188347-110188369 ATGCAAGTCCAAAACTCAGCAGG + Intergenic
959785620 3:110294456-110294478 ATGCAAGTCCAAAATCAAGTGGG + Intergenic
959815705 3:110671200-110671222 ATGCAAGTTCAAAATTCAGCAGG - Intergenic
959838938 3:110951658-110951680 ATGCAAATCCAAAACCCAGCAGG - Intergenic
959893591 3:111583167-111583189 ATGCAAGTCCAAAATCCAAAAGG + Intronic
959973488 3:112432463-112432485 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
960021894 3:112964507-112964529 ATGCAAGTCCAAAATCCAGCAGG - Intronic
960364913 3:116759586-116759608 ATGCAAGGTAAAAAGTGAGAAGG - Intronic
960542031 3:118871829-118871851 ATGCAAGTCCAAAACACAGAAGG - Intergenic
960670901 3:120154676-120154698 GTGCAAGTCCAAAACCCAGTGGG + Intergenic
960858079 3:122123362-122123384 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
961067561 3:123889461-123889483 ATGCAAATCCAAAACTCAGCAGG + Intergenic
962035102 3:131643342-131643364 ATGCAAGTCCAAAATCCAAAAGG - Intronic
962128913 3:132651762-132651784 ATGCAAGTCCAAAATCCAGTGGG - Intronic
962162505 3:133013850-133013872 ATGCAAGTCTGAAACTCAGCAGG - Intergenic
962711877 3:138094017-138094039 AGGCATGTCGAAAGCTGAGATGG - Intronic
963073339 3:141323227-141323249 GAGCAAACCCAAAACTGAGATGG - Intergenic
963173163 3:142271603-142271625 CTGCAAGTCCAAAAATAAGACGG + Intergenic
963368366 3:144367179-144367201 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
963418418 3:145028076-145028098 ATGCAAGTCCAAAATTCAGTGGG - Intergenic
963422010 3:145072925-145072947 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
963441395 3:145344630-145344652 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
963494776 3:146045267-146045289 ATACAAGTCCAAAACCAAGCAGG + Intergenic
963592918 3:147286100-147286122 ATGCAAGTCCAAAATCAAGCAGG + Intergenic
963716761 3:148812110-148812132 ATGCAAGTCCAAAATCCAGTTGG - Intronic
963816574 3:149838038-149838060 ATGCAAGTCCAAAATCCAGCGGG + Intronic
963945911 3:151145432-151145454 ATGCAAGTCTGATACTCAGAAGG - Intronic
964092326 3:152892029-152892051 ATGCAAGTCTAAAACCCAGAAGG + Intergenic
964150443 3:153518268-153518290 ATGCAATTCCAAAATTCAGCAGG + Intergenic
964241564 3:154600951-154600973 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
964267862 3:154920866-154920888 GTGCAAGTCCAAAACCCAGCAGG + Intergenic
964683020 3:159363031-159363053 TTGGAAGTAGAAAACTGAGAAGG - Intronic
964836241 3:160941071-160941093 ATGCAAGTCCCAAATTCAGCAGG - Intronic
964853449 3:161119516-161119538 ATGCAAGTCCAAAACCCAGCAGG - Intronic
964895462 3:161590348-161590370 ATGAAAGTCCAAAATTTAGCAGG + Intergenic
964920092 3:161885614-161885636 ATGCAAGTTCAAAACCCAGCAGG - Intergenic
964933942 3:162059159-162059181 ATGCAGGTCCAAAACCCAGCAGG + Intergenic
965046438 3:163584455-163584477 ATGAAAGTCCAAAACCCAGCAGG + Intergenic
965458109 3:168929472-168929494 ATGCAAGTCCAAAATCCAGGGGG + Intergenic
965500091 3:169445891-169445913 ATGCAAGTCCAAAATCCAGTGGG - Intronic
965662198 3:171053329-171053351 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
965795249 3:172432653-172432675 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
966059106 3:175733838-175733860 ATGCAAGTCCAAAATCCAGCAGG + Intronic
966302758 3:178497249-178497271 ATGCAAGTCCAAAACCCAGCAGG - Intronic
966446495 3:180007214-180007236 ATGCAAGTCCAAAATCCAGTGGG + Intronic
966466189 3:180233440-180233462 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
966500710 3:180635573-180635595 ATGCAAGTCCAAAACCTGGCAGG + Intronic
966576785 3:181511326-181511348 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
967450105 3:189613823-189613845 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
967501658 3:190204469-190204491 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
967519790 3:190416280-190416302 ATGCAAGTCCAAAACCCAGTGGG + Intergenic
967559545 3:190901961-190901983 ATGCAACTCCAAAACCCAGAAGG - Intergenic
967567473 3:190988924-190988946 ATGCAAGTCCAAAACCTAGCAGG - Intergenic
967602358 3:191405130-191405152 AAGCAAGTCCAAAACCCAGCAGG + Intergenic
967622481 3:191650491-191650513 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
967634938 3:191790493-191790515 GTGCAAGTCCAAAATCCAGAAGG + Intergenic
967776941 3:193394888-193394910 ATGCAAGTCCAAAATCCAGTCGG + Intergenic
968392303 4:203634-203656 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
968530588 4:1089313-1089335 ATGCAAGTCCAGAACCCAGCAGG - Intronic
969128813 4:4975300-4975322 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
969176954 4:5406135-5406157 ATGCAAGTCCAAAACCCAGCAGG + Intronic
969190240 4:5512646-5512668 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
969904739 4:10383454-10383476 ATACAAGTCCAAAATTCAGTGGG - Intergenic
970097353 4:12479082-12479104 ATGCAAGTTCAAAACCCAGCAGG + Intergenic
970099283 4:12502693-12502715 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
970306032 4:14733662-14733684 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
970357477 4:15269999-15270021 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
970567856 4:17349964-17349986 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
970577652 4:17443773-17443795 ATGCAAATCCAAAACCCAGTGGG + Intergenic
970742133 4:19251044-19251066 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
970976427 4:22047825-22047847 ATGCAAGTCCAAAATCTAGCAGG + Intergenic
971069894 4:23079715-23079737 ATGCAAGTCCAAAATCCAGTAGG + Intergenic
971593406 4:28497552-28497574 ATGCAAATTCAAAACCCAGAAGG + Intergenic
971684393 4:29746305-29746327 ATGCAAGTCCAAAACCCAGAAGG + Intergenic
971841007 4:31851636-31851658 ATGCAAGTCCAAAATCCAGCTGG - Intergenic
971889938 4:32507258-32507280 ATGCAAGTCAGAAACCCAGAAGG - Intergenic
971932488 4:33102877-33102899 ATGCAAGTCCAAAAGTAAAATGG - Intergenic
972056126 4:34805735-34805757 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
972137427 4:35909049-35909071 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
972237080 4:37147035-37147057 ATGCAAGTCCAAAATTCAACAGG - Intergenic
972844339 4:42970025-42970047 ATGCAAGTCCAAAACCCAGCAGG + Intronic
972847228 4:43004667-43004689 ATTCAAGTCCAAAACCCAGCAGG - Intronic
972878597 4:43396026-43396048 ATGCAAGTCCAAAACCCAGTAGG - Intergenic
973010806 4:45070208-45070230 ATGCAAGTCCAATACCCAGTAGG - Intergenic
973047829 4:45556482-45556504 ATGCAACTCTGGAACTGAGATGG + Intergenic
973107841 4:46361873-46361895 ATGCAAGTCCAAAATCTAGTGGG - Intronic
973214950 4:47658204-47658226 ATGCAAGCCCAAAACCCAGCAGG + Intronic
973300525 4:48577993-48578015 ATTCAAATCCAAAAGTAAGAAGG + Intronic
973367011 4:49216019-49216041 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
973367074 4:49216453-49216475 ATGCAAGTCAAAAACCCAGCAGG + Intergenic
973367408 4:49218895-49218917 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
973368287 4:49225395-49225417 ACGCAAGTCCAAAACCCAGGAGG + Intergenic
973392758 4:49570030-49570052 ACGCAAGTCCAAAACCCAGGAGG - Intergenic
973393550 4:49575953-49575975 ATGCAAGTCAAAAACCCAGCAGG - Intergenic
973393612 4:49576386-49576408 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
973732164 4:53833102-53833124 ATGCAAGCCCAAAACCCAGCAGG - Intronic
974145185 4:57937656-57937678 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
974148513 4:57975594-57975616 ATGCAAATTCAAATCAGAGAAGG - Intergenic
974171428 4:58271181-58271203 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
974202730 4:58662494-58662516 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
974267535 4:59604059-59604081 ATCCAAGTCCAAAACCCAGCAGG - Intergenic
974287247 4:59884497-59884519 TTGCAAGTGCAAAATTTAGAGGG - Intergenic
974485166 4:62494790-62494812 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
974555768 4:63445774-63445796 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
974608385 4:64183503-64183525 ATGCAAGTCTAAAACCCAGGAGG + Intergenic
974724250 4:65778090-65778112 ATGCAAGTCCAAAATCTAGCAGG - Intergenic
974779210 4:66529339-66529361 ATGCAAGTCCAAAATCCAGTAGG - Intergenic
974845950 4:67351414-67351436 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
974973941 4:68866494-68866516 AGGCAAGTCCAAAACCCAGCAGG - Intergenic
975186590 4:71410435-71410457 ATGCAAGTCCAAAATCCAGTGGG - Intronic
975350363 4:73339256-73339278 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
975918003 4:79347677-79347699 ATGCAAGTCCAGATTTCAGAGGG - Intergenic
976287488 4:83384635-83384657 ATGCAAGTCCGAAACCCAGCAGG + Intergenic
976453594 4:85219877-85219899 ATGCAAGTTCAAAACTCAGCAGG - Intergenic
976503060 4:85814500-85814522 ATGCAAGTCCAAAATCCAGCAGG + Intronic
976636053 4:87287276-87287298 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
976660462 4:87535297-87535319 AAGCAAGTTCAAAACAGAGCAGG + Intergenic
977189206 4:93978308-93978330 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
977197438 4:94080939-94080961 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
977197806 4:94083684-94083706 TTGCAAGTCCAAAACCCAGTGGG + Intergenic
977247275 4:94648120-94648142 AACTAAGTCCAAAACTTAGAAGG + Intronic
977339931 4:95744855-95744877 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
977368325 4:96101804-96101826 ATGCAAGTCCAAAATCCAGGGGG - Intergenic
977396636 4:96479156-96479178 ATGCAAGGCCAAAACCCAGCAGG - Intergenic
977579136 4:98705282-98705304 ATGCAAGTCCAAAATTCAATAGG - Intergenic
977703994 4:100051640-100051662 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
977988599 4:103415313-103415335 ATGCAAGCCCAAAATCCAGAAGG - Intergenic
978043639 4:104099813-104099835 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
978213095 4:106162166-106162188 ATGCAAGTCCAAAATTCAGCAGG + Intronic
978322755 4:107516088-107516110 ATGCAAGTCCAAAATCTAGCAGG - Intergenic
978492382 4:109322940-109322962 ATGCAAGTCCAAAACCCAACAGG + Intergenic
978696265 4:111584072-111584094 ATGCAAGTCTGAAACTCAGCAGG + Intergenic
978934070 4:114354536-114354558 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
978939160 4:114415972-114415994 ATGCAAGTCCAAAATCCAGCGGG - Intergenic
978981928 4:114957799-114957821 ATGAAAGTCCAAAATCCAGAAGG + Intronic
979065863 4:116132422-116132444 ATGCAAGTCCAAAATCCAGCGGG + Intergenic
979078467 4:116304117-116304139 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
979122516 4:116921048-116921070 ATGCAAGTCCAGAACCCAGCAGG - Intergenic
979183478 4:117758403-117758425 ATGCAAGTCCAAAATGCAGCAGG - Intergenic
979369962 4:119873248-119873270 ATGCAATTACAAAGCAGAGAAGG + Intergenic
979373176 4:119913982-119914004 ATGCAAGTCTAAAACCCAGCAGG + Intergenic
979420682 4:120502001-120502023 ATGCAAATCCAAAACCTAGCAGG + Intergenic
979645101 4:123059084-123059106 ATGCAAGTCCAAAATCCAGCAGG + Intronic
979881868 4:125970396-125970418 ATGCAAGTCTAAAACACAGCAGG + Intergenic
979948116 4:126859933-126859955 ATGCAGGTCCAAAACCCAGACGG + Intergenic
980065828 4:128187422-128187444 ATGCAAGTCCAAAGCCCAGAAGG - Intronic
980132978 4:128833920-128833942 ATGCTAGTCCAGAAAAGAGAAGG - Intronic
980202843 4:129677727-129677749 ATGCAAGTCCAAAATCCAGCGGG - Intergenic
980448525 4:132942704-132942726 ATGCAAGTTCAAAACCCAGCAGG + Intergenic
980545737 4:134259665-134259687 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
980672402 4:136026419-136026441 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
980846677 4:138332955-138332977 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
981131452 4:141162281-141162303 ATGCAAGTCCAAAACCCAGCAGG - Intronic
981275468 4:142893882-142893904 ATGCAAGTCCAAAACTCAACAGG - Intergenic
981281602 4:142965804-142965826 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
981351441 4:143734265-143734287 GTGCAAGTCCAAAACCCAGCAGG + Intergenic
981391609 4:144197344-144197366 CTGCAAGTCCAAAACCCAGCAGG - Intergenic
981503031 4:145473007-145473029 ATGCAAGTTCAAAACCCAGCAGG + Intergenic
981643110 4:146967704-146967726 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
981707338 4:147674601-147674623 AGTCAAGTGCAATACTGAGAAGG + Intronic
981861569 4:149362083-149362105 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
982389842 4:154852315-154852337 ATGCAAGTCCAAAATCCAGGGGG + Intergenic
982432482 4:155338540-155338562 ATGCAAGTCCAAAACCCAGAAGG - Intergenic
982797454 4:159663364-159663386 ATGCAAGTCTGAAACCCAGAGGG + Intergenic
982868130 4:160543649-160543671 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
983083461 4:163415144-163415166 ATGCAAGTCCAAAATCCAGGAGG - Intergenic
983132775 4:164042879-164042901 ATGCAAGTCCAAAACCCAGCAGG + Intronic
983378269 4:166957729-166957751 ATGCAAGTCCAAAACACCGCAGG - Intronic
983478331 4:168242546-168242568 ATGCAAGTCCAAAATCCAGTGGG - Intronic
983889567 4:173016534-173016556 ATGCAAGTCCAAAATCCAGTGGG - Intronic
984117140 4:175695511-175695533 ATGCAAGTCCAAAATCTAGCAGG - Intronic
984316110 4:178134541-178134563 TGGCAACACCAAAACTGAGAAGG - Intergenic
984327062 4:178268440-178268462 ACGCAAGTCCAAAATCCAGAGGG + Intergenic
984355713 4:178654765-178654787 ATACAAGTCCAAAATCCAGAAGG - Intergenic
984416065 4:179459574-179459596 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
984822971 4:183899356-183899378 AGGCATGTCCAAAGCTGAGATGG + Intronic
985183921 4:187296016-187296038 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
985304397 4:188522504-188522526 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
985371798 4:189292784-189292806 ATGCAAGTCCAAAACCAATCAGG - Intergenic
985417768 4:189753904-189753926 ATGCAAGTCCAAAATGCAGCAGG - Intergenic
985431755 4:189887969-189887991 ATGCAAGTCCAAAATTCAATGGG + Intergenic
1202764511 4_GL000008v2_random:138536-138558 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1202764571 4_GL000008v2_random:138969-138991 ATGCAAGTCAAAAACCCAGCAGG + Intergenic
985617698 5:933939-933961 ATGCGAGTCCAAAACTCAGCAGG + Intergenic
985730145 5:1543175-1543197 TAGCCAGTCCAGAACTGAGAGGG - Intergenic
986039108 5:3969692-3969714 AGGCAAGTCCAAAATCAAGAGGG + Intergenic
986079604 5:4376249-4376271 CTGCAAGTGCAAAGCTGAGCTGG + Intergenic
986096457 5:4559145-4559167 ATGCAAGTCCAAGAACTAGATGG - Intergenic
986533458 5:8762261-8762283 ATGCAAGTCCAAAATCCAAAAGG - Intergenic
986538391 5:8816310-8816332 ATGCAAGCCCAAAACTCAGCAGG - Intergenic
986582418 5:9279253-9279275 ATGCAAGTCCAAAACCCAGCAGG - Intronic
986601624 5:9478599-9478621 ATGCAAGTCCAAAACTGAGAAGG - Intronic
986797487 5:11226088-11226110 CTACAAGTCCAAGATTGAGAAGG - Intronic
986852517 5:11830014-11830036 ATGCAAGTCCAAAATCCAGCAGG - Intronic
986900259 5:12422218-12422240 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
986924530 5:12731072-12731094 ATGTAAGTCCAAAACTTAGCAGG + Intergenic
986983517 5:13475390-13475412 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
987003856 5:13689087-13689109 ATGCAAGTCCAAAACCCAAGAGG - Intergenic
987102495 5:14604711-14604733 ATGCAAGTCCAAAATCCAGCAGG + Intronic
987201653 5:15583562-15583584 ATGCAAGTCCAAAATCCAGCAGG + Intronic
987260315 5:16196042-16196064 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
987416992 5:17672082-17672104 ATCCAGGTCCAAGACTGAGGAGG - Intergenic
987510384 5:18829227-18829249 ATGCAAGTCCAAAAGCCAGCAGG - Intergenic
987531738 5:19130348-19130370 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
987535120 5:19176365-19176387 AGGCCAGTTCAAAACTCAGAGGG + Intergenic
987658488 5:20839852-20839874 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
987659635 5:20855425-20855447 ATGCAAGTCCAAAATCCAGCGGG - Intergenic
987663228 5:20904607-20904629 ATGCAAGTTCAAAACCCAGAAGG + Intergenic
987680850 5:21133960-21133982 ATGTAAGTCCAAAATCTAGAAGG - Intergenic
987708959 5:21485579-21485601 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
988016156 5:25562973-25562995 ATGCAAGTCCAAAACACAGCAGG + Intergenic
988038708 5:25860851-25860873 ATGCAAGTCCAAAATCTAGCAGG + Intergenic
988040867 5:25887822-25887844 ATGCAAGCCCAAAACCCAGCAGG + Intergenic
988074715 5:26338270-26338292 CAGCAAGTCCAAAACTCAGCAGG + Intergenic
988099193 5:26656481-26656503 ATGCAAGTCTAAAATTCAGTAGG + Intergenic
988113626 5:26855148-26855170 ATGCAAGTCTAAAACTCAGCAGG + Intergenic
988196946 5:28015913-28015935 ATCCAAGTCCAAAATTCAGTGGG - Intergenic
988366844 5:30310823-30310845 ATGCAAGTCCGAAACCCAGCAGG - Intergenic
988394572 5:30680243-30680265 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
988426773 5:31073884-31073906 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
988647359 5:33108914-33108936 ATGCAAGTCTAAAACTCAGGAGG - Intergenic
988668864 5:33359900-33359922 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
988692285 5:33584921-33584943 ATACAAGGCCAGAACTAAGATGG + Intronic
988740043 5:34061123-34061145 ATGCAAGTCCAAAATCTAGCAGG + Intronic
988750655 5:34188567-34188589 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
988759463 5:34297578-34297600 ATGCAAGTTCAAAACCCAGAAGG - Intergenic
988764009 5:34350222-34350244 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
988765197 5:34366092-34366114 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
988804563 5:34728088-34728110 ATGCAAGTCCAAAATCCAGAGGG - Intronic
988886472 5:35563657-35563679 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
989067718 5:37480988-37481010 ATGCAAGTCCAAAACCCAGCAGG + Intronic
989228994 5:39065721-39065743 ATGCAAGTTCAAAACCCAGCAGG + Intronic
989254354 5:39350623-39350645 ATGCAAGTCCAAAACCCAGTTGG + Intronic
989434744 5:41397858-41397880 ATGCAAGTCAAAAACCCAGCAGG - Intronic
989696978 5:44212921-44212943 ATGCAAGTCCAAAATCCAGCTGG - Intergenic
989746909 5:44839842-44839864 ATGCAAGTCCAAAACCCAGTGGG - Intergenic
989778045 5:45232720-45232742 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
989984862 5:50686251-50686273 CTGCAAGTCCAAAATTCAGCAGG + Intronic
990126000 5:52518452-52518474 ATGCAAGTCCAAAATCCAGCGGG - Intergenic
990193229 5:53285902-53285924 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
990429235 5:55718097-55718119 ATGCAAGTCCAAAATCCAGTGGG - Intronic
990789065 5:59455871-59455893 ATGCAAGTCCAAAATCCAGCAGG - Intronic
990883681 5:60568469-60568491 ATGTAAGTCCAAAACCCAGCAGG + Intergenic
990903512 5:60778984-60779006 ATGCAAGTCCAAAATCCAGTAGG + Intronic
990939965 5:61192134-61192156 ATGCCAATCCAAAAGTGTGAGGG + Intergenic
990941387 5:61206174-61206196 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
991039257 5:62159192-62159214 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
991186631 5:63815990-63816012 ATGCAAGTCCTAAACACAGCAGG - Intergenic
991616107 5:68498468-68498490 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
991735796 5:69630492-69630514 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
991738924 5:69651780-69651802 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
991759274 5:69904651-69904673 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
991788062 5:70213471-70213493 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
991790499 5:70231521-70231543 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
991812290 5:70486131-70486153 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
991815249 5:70506608-70506630 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
991818385 5:70527897-70527919 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
991838503 5:70779717-70779739 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
991880509 5:71213835-71213857 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
991882946 5:71231856-71231878 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
991978450 5:72206430-72206452 CTGCAAGTTCAAGACTGAAATGG + Exonic
992215914 5:74524503-74524525 ATGCAAGTCCAAAATCTAGCAGG - Intergenic
992415635 5:76550242-76550264 AAGCAAGTCCAAAACCTAGCTGG + Intronic
992651472 5:78864832-78864854 ATGCAAGTCCAAAATCCAGTGGG + Intronic
992924520 5:81567836-81567858 ATGCAAGTCCAAAATTCAGCAGG - Intronic
993190197 5:84670954-84670976 GTGCAAGTCCAAAACCCAGCAGG - Intergenic
993225986 5:85167668-85167690 ATGGAAGTCCAAAATTTAGTGGG - Intergenic
993443015 5:87979171-87979193 ATGCAAGTCCAAAACCCGGCAGG - Intergenic
993581038 5:89661281-89661303 ATGCAAGTCCAAAACACAACAGG - Intergenic
993638170 5:90370831-90370853 ATGCAAGTCCAAAATTCAATGGG + Intergenic
993801860 5:92352012-92352034 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
993893632 5:93505145-93505167 ATGCAAGTCCAAAATCCAGTAGG + Intergenic
994073666 5:95628450-95628472 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
994285233 5:97956323-97956345 ACGCAAGTCCAAAACCCAGCAGG - Intergenic
994380112 5:99060838-99060860 AGTCAAGTCCTAAATTGAGAAGG - Intergenic
994421080 5:99526924-99526946 ATGCAAATCCAAAACCCAGCAGG + Intergenic
994485961 5:100387390-100387412 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
994548805 5:101205456-101205478 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
994549221 5:101209090-101209112 ATGGAAGTCCAAAACCCAGTGGG - Intergenic
994592433 5:101789649-101789671 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
994828610 5:104747559-104747581 ATGCAAGTCCAAAATCTAGCTGG - Intergenic
994831303 5:104786568-104786590 ATGCAAGTCCAAAATTCAGCAGG - Intergenic
994895525 5:105697694-105697716 ATGCAAGTCCAAAATTCAGCGGG + Intergenic
994936127 5:106255641-106255663 ATGCAAGTTCAAAACCTAGCAGG - Intergenic
995429177 5:112055237-112055259 ATGCAAGTCCAAAATTGAATAGG - Intergenic
995559371 5:113364294-113364316 ATGCAAGTCCAAAACCCAGCAGG + Intronic
995774552 5:115711522-115711544 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
995875568 5:116785875-116785897 ATATAAGTCTAAAGCTGAGAAGG - Intergenic
995929130 5:117414764-117414786 TTGCAAATCCAAAACTGATTTGG + Intergenic
996026945 5:118657168-118657190 ATGCAAGTTCAAAACCCAGCAGG + Intergenic
996046684 5:118882180-118882202 ATGCAAGTCCAAAACCCAGCTGG + Intronic
996098186 5:119421023-119421045 ATGCAAGTCCAAAATCCAGAGGG - Intergenic
996222468 5:120950310-120950332 ATGCAAGTCCAAAATACAGTGGG - Intergenic
996222889 5:120954267-120954289 ATGCAAGTCCAAAATCCAGTTGG - Intergenic
996453631 5:123655841-123655863 ATGCAAGTCCAAAGCCCAGTGGG + Intergenic
996641698 5:125762205-125762227 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
996829099 5:127720293-127720315 ATGCAAGTCCAAAACTCAGCAGG + Intergenic
996839826 5:127836169-127836191 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
997036771 5:130202420-130202442 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
997789415 5:136743585-136743607 ATGCAAGTCCCAAACCCAGCAGG - Intergenic
997856938 5:137381103-137381125 ACGCAAGTCCAAAACTGAGCAGG + Intronic
998723065 5:144975961-144975983 ATGCAAGTCCAAAATCCAGAGGG - Intergenic
998813880 5:145993107-145993129 ATGCAAGTCCAAAATCAAGTGGG + Intronic
999906231 5:156143679-156143701 ATGCAAGTCCAAAACCCAGCAGG - Intronic
999986153 5:157007404-157007426 ATGCAAGTCTAAAACCCAGCAGG + Intergenic
1000270420 5:159678679-159678701 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1000548779 5:162633732-162633754 GTGCAAGTCCAAAACCCAGCAGG + Intergenic
1000741541 5:164975241-164975263 ATGCAAGTCCAAAATTCAGTGGG - Intergenic
1000830187 5:166093069-166093091 ATGCAAGTTCAAAACCCAGCAGG + Intergenic
1001194816 5:169663128-169663150 ATGCAAGTCCAAAACCCAGCTGG + Intronic
1001780554 5:174365290-174365312 ATTCAAGTTCAATACTGAAAGGG + Intergenic
1002009237 5:176263984-176264006 ATGCAAGTCCAGAACTCAGCAGG + Intronic
1002217484 5:177648299-177648321 ATGTAAGTCCAGAACTCAGCAGG - Intergenic
1002535693 5:179874269-179874291 AGGCAGGTCAAAGACTGAGAGGG + Intronic
1003000307 6:2325618-2325640 ATGCAAGTCCAAAACCCAGAAGG - Intergenic
1003484342 6:6562904-6562926 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1004245704 6:13973130-13973152 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1004565096 6:16788868-16788890 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1004592873 6:17070424-17070446 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1004624104 6:17358547-17358569 ATGCAAGTCTGAAACTCAGCAGG - Intergenic
1004661656 6:17715945-17715967 AAGAAAATCCAAAACTGAGATGG + Intergenic
1005548727 6:26894872-26894894 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1005655198 6:27928696-27928718 AGGCAAGTCCAAAATTTAGTGGG + Intergenic
1005984056 6:30859549-30859571 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1007020655 6:38517486-38517508 ATACAAGTCCAAAAGTGACTTGG - Intronic
1007021559 6:38526715-38526737 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1007908867 6:45492473-45492495 ATGTAAGCCCAAATCTGAGAGGG - Intronic
1008245007 6:49161135-49161157 ATGCAAGTCCAAAATCCAGCTGG + Intergenic
1008344243 6:50406796-50406818 ACAGAAGTCCAAAACTCAGATGG - Intergenic
1008571494 6:52821373-52821395 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1008911691 6:56740413-56740435 ATGCAAGCACAAAAGAGAGAAGG + Intronic
1008918269 6:56813729-56813751 ATGAAAATTCAAAAATGAGATGG + Intronic
1008930239 6:56931733-56931755 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1009019481 6:57935984-57936006 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1009030857 6:58056563-58056585 CTGAAAGTCCAAAATTGAGTGGG + Intergenic
1009206711 6:60811024-60811046 GTGAAAGTCCAAAATTGAGTGGG + Intergenic
1009348531 6:62646734-62646756 ATGCAAGTACAAAATTCAGTGGG - Intergenic
1009396689 6:63207286-63207308 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1009503223 6:64443210-64443232 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1009652920 6:66499391-66499413 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1009693801 6:67069709-67069731 ATGCAAGTCCAAAATGCAGCGGG - Intergenic
1009732241 6:67622835-67622857 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1010074344 6:71783448-71783470 AGGCAAGTCCAAAACCTAGGAGG + Intergenic
1010248277 6:73682339-73682361 ATGCAAGTCCAAAATCTAGTGGG + Intergenic
1010411385 6:75566207-75566229 ATGCAAGTCTGAAACTCAGCAGG + Intergenic
1010517333 6:76789563-76789585 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1010527816 6:76924892-76924914 ATGCAAATCCAAAACCCAGCAGG - Intergenic
1010531028 6:76967234-76967256 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1010678164 6:78768272-78768294 ATGCAAGTCTGAAACTCAGCAGG - Intergenic
1010868274 6:81006804-81006826 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1010920302 6:81672774-81672796 ATGCAAGTCCAAAATCCAGCAGG + Intronic
1010978245 6:82340901-82340923 ATGCAAGTCCTAAACCCAGCAGG + Intergenic
1010981645 6:82376184-82376206 ATGCAAGTCCAAAATCCAGTAGG + Intergenic
1011088750 6:83571490-83571512 ATGCAAGTCCAAAATCCAGTGGG - Intronic
1011150365 6:84265697-84265719 AAGCAAGTAAAAGACTGAGATGG - Intergenic
1011245674 6:85318639-85318661 ATGCAAGTTCAAAACCCAGCAGG - Intergenic
1011261633 6:85476275-85476297 CTCCATGTCCAAAACTGAAATGG + Intronic
1011263991 6:85496876-85496898 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1011385729 6:86796074-86796096 ATGCAAGTCCAAAATTGAGTGGG + Intergenic
1012210290 6:96510374-96510396 ATGCAAGTCCAATACCCAGAAGG - Intergenic
1012281119 6:97329039-97329061 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1012349374 6:98232330-98232352 ATGCAACTCCAAAACCCAGGAGG + Intergenic
1012485964 6:99722828-99722850 ATGCAAGTCCAAAATCCAGGGGG - Intergenic
1012751463 6:103168548-103168570 ATGCAACTTCAAAACTCAGCAGG - Intergenic
1012826291 6:104151200-104151222 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1013149129 6:107426764-107426786 ATGCAAGTCCAAAATCAAGCAGG - Intronic
1013717265 6:112976549-112976571 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1013863219 6:114660983-114661005 ATGCAAGTCCGAAATCCAGAGGG - Intergenic
1014043030 6:116851220-116851242 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1014075542 6:117230626-117230648 TTGCAAGTCCAAAACCCAGTAGG + Intergenic
1014475887 6:121871932-121871954 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1014621617 6:123674540-123674562 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1014668775 6:124272878-124272900 ATGCAAGTTCAAAACCCAGTAGG - Intronic
1014730884 6:125030554-125030576 ATGCAAGTCCAAAATCCAGTAGG + Intronic
1014771012 6:125458182-125458204 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1014875657 6:126655528-126655550 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1015377944 6:132532007-132532029 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1015652580 6:135479462-135479484 ATGCAAGTCCAGAACCCAGCAGG - Intronic
1015677032 6:135761933-135761955 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1015684661 6:135846597-135846619 ATGGAAGTCCAAGAATAAGATGG + Intergenic
1015901822 6:138075491-138075513 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1016126392 6:140408886-140408908 ATGCAAGTCCAAAACTCAGCAGG - Intergenic
1016166077 6:140945273-140945295 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1016208917 6:141505001-141505023 ATGCAAGTCCAAAATCCAGCGGG + Intergenic
1016244527 6:141966685-141966707 ATGCAAGTCCAAAATCCAGCGGG + Intergenic
1016564116 6:145433254-145433276 AGGCATGTCTAAATCTGAGATGG - Intergenic
1016564768 6:145440698-145440720 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1016987964 6:149909298-149909320 ATGCAAGTCCAAAACCCAGTGGG - Intergenic
1018041078 6:159922601-159922623 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1018477646 6:164159137-164159159 ATGCAAGTCCAAAATCGAAAAGG + Intergenic
1018721654 6:166577537-166577559 ATGCAAGTCCAAAATCCAGTGGG - Intronic
1018866824 6:167752901-167752923 ATGCAAGTCCAAAATCCAGCGGG + Intergenic
1019150351 6:170001369-170001391 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1019648572 7:2144025-2144047 AAGCAAGGCCAAAGCCGAGACGG + Intronic
1020388385 7:7632300-7632322 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1020456069 7:8374714-8374736 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1020470191 7:8526213-8526235 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1020537796 7:9423863-9423885 ATGCAAGTCCAAAATCAAGTGGG + Intergenic
1020754987 7:12190786-12190808 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1020809462 7:12833649-12833671 ATGCAAGTCCGAAACTCATGGGG + Intergenic
1020885717 7:13816950-13816972 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1020902428 7:14021681-14021703 ATCAAAGTCCAAAAATCAGATGG + Intergenic
1021036768 7:15809527-15809549 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1022344273 7:29499149-29499171 ATGAAAATCCAAAGCTGAAAAGG - Intronic
1022512652 7:30950541-30950563 ATGCAAGTTCAAAACTCAGCAGG - Intronic
1022549787 7:31227805-31227827 ATGCAAGTCCAAAACCCAGCGGG - Intergenic
1022678466 7:32522435-32522457 ATGCAAGTCCAGAATTCAGTGGG - Intronic
1022712505 7:32865018-32865040 ATGCAAGTCCAAAACTCAGCAGG + Intergenic
1022735356 7:33070829-33070851 ATGCAAGTCCAAAACCCAGTAGG - Intergenic
1022852689 7:34281816-34281838 ATGCAAGTCCAAAATTCAGTGGG + Intergenic
1022910498 7:34895985-34896007 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1022948911 7:35316857-35316879 ATGCAAGACCAGAACAGACATGG - Intergenic
1023188449 7:37554783-37554805 ATGCAAGTCCAAAGCCCAGTAGG + Intergenic
1023274030 7:38498873-38498895 ATGCAAGCAGAAAACTGAGCTGG - Intronic
1023386297 7:39661533-39661555 ATGCAAGTCCAAAATCCAGCAGG + Intronic
1023669442 7:42560581-42560603 ATGCAAGTCCAAAACCCAGCGGG - Intergenic
1023690372 7:42779750-42779772 ATGCAAGTCCAAAACCCACCAGG - Intergenic
1024162228 7:46688491-46688513 ATGCAAGTCCGAAACCCAGCAGG + Exonic
1024383118 7:48722473-48722495 ATGCAAGTTCAAAACCCAGCAGG + Intergenic
1024406498 7:48988023-48988045 TTGCAAGTTCAAAACACAGAGGG - Intergenic
1024413705 7:49078547-49078569 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1024415174 7:49097390-49097412 ATGCAAGTCCAAAACATGGCAGG + Intergenic
1024424684 7:49212203-49212225 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1024487251 7:49932448-49932470 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1024778707 7:52821418-52821440 ATGCAAGTCCGAAACCCAGAAGG + Intergenic
1024814920 7:53257276-53257298 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1026120044 7:67529088-67529110 GTGCAAGTCCAAAATTCAGTAGG + Intergenic
1026333068 7:69369988-69370010 CTGGAAGTTCATAACTGAGATGG - Intergenic
1027341069 7:77209296-77209318 ATGCAAATCCAAAACCCAGCAGG + Intronic
1027395195 7:77746818-77746840 ATGCAAGTCCGAAACCCAGCAGG + Intronic
1027937908 7:84632745-84632767 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1027958967 7:84919449-84919471 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1027996836 7:85435075-85435097 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1028011310 7:85648348-85648370 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1028066490 7:86391406-86391428 ATGCAAGTCCAAAATACAGTGGG + Intergenic
1028099158 7:86798443-86798465 ATGCAAGTCCAAAATCCAGTAGG - Intronic
1028126178 7:87115495-87115517 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1028134381 7:87210568-87210590 ATGCAAGTCTAAAACCCAGCAGG + Intronic
1028138422 7:87246225-87246247 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1028207302 7:88032359-88032381 ACGCAAGTCCAAAACCCAGCAGG - Intronic
1028301362 7:89205541-89205563 ATGCAAGTCCAAAATCCAGTGGG + Intronic
1028784313 7:94774350-94774372 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1029047544 7:97645809-97645831 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1030144609 7:106340859-106340881 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1030357246 7:108556504-108556526 ATGCAAGTCCAAAACCAAGCAGG + Intronic
1030510829 7:110480572-110480594 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1030516913 7:110550386-110550408 ATGCAAATCCAAAACCCAGAAGG + Intergenic
1030829888 7:114208282-114208304 ATGCAAGTCCAAAATCCAGTAGG - Intronic
1030915249 7:115304303-115304325 ATGCAAGTCCAAAATCCAGCGGG - Intergenic
1031182244 7:118433376-118433398 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1031288871 7:119907692-119907714 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1031360603 7:120844564-120844586 ATGCAAGTCCCAAACCCAGCAGG + Intronic
1031583399 7:123505052-123505074 ATGCAAGTTCAAAACCCAGCAGG + Intronic
1031618181 7:123905302-123905324 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1032053232 7:128662876-128662898 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1032318346 7:130861627-130861649 ATGCAAGTCCAAAATGCAGTGGG - Intergenic
1033063383 7:138129103-138129125 ATGTAAGTCCAAAACCCAGCAGG + Intergenic
1033837681 7:145335415-145335437 ATGCAAGTCCAAAATTCAATAGG + Intergenic
1034037255 7:147837738-147837760 ATGCAAGTCCAAAATCCAGCAGG + Intronic
1034040673 7:147873919-147873941 ATGCAAGTCCAAAATTCAACAGG + Intronic
1034739759 7:153462906-153462928 ATGCAAGTCCAAAACCCAACAGG - Intergenic
1034743315 7:153498388-153498410 AGGCAAGTAGAAAGCTGAGATGG + Intergenic
1034851981 7:154502051-154502073 ATGCAAGTCCAAAATCTAGCAGG - Intronic
1035120670 7:156564134-156564156 ATGCAAGTCCGAAACCCAGCTGG + Intergenic
1035180403 7:157085194-157085216 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1036025221 8:4900171-4900193 ATTCAAGTCCCAAAGTGACAGGG + Intronic
1037206082 8:16321292-16321314 ATGCAAGTCCAAAATCCAGTGGG - Intronic
1038684385 8:29702972-29702994 ATGCAAGTCCAAAATACAGCAGG - Intergenic
1039158908 8:34595342-34595364 ATGCAAGTCTGAAACCCAGAAGG + Intergenic
1039642674 8:39241092-39241114 ATGCAAGTCCAAAATCCAGCAGG + Intronic
1040078002 8:43259799-43259821 ATGCAAGTCTAAAACCCAGCAGG + Intergenic
1040103569 8:43525895-43525917 ATGCAAGTCCAAAACTCAGCAGG - Intergenic
1040764971 8:50898014-50898036 ATGCAAGCCCCACACTCAGAAGG + Intergenic
1040945863 8:52883466-52883488 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1041013911 8:53571691-53571713 ATGCAAGTCCAAAACCCACAGGG - Intergenic
1041223014 8:55670591-55670613 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1041392603 8:57360140-57360162 ATGCAAGTTCAAAACCCAGCAGG - Intergenic
1041927669 8:63252979-63253001 ATGCAAGTCCAAAACCCAGTGGG - Intergenic
1042412592 8:68481683-68481705 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1042432726 8:68727217-68727239 ATGCAAGTCCAAAATCCAGCGGG + Intronic
1042466280 8:69133010-69133032 ATGCAAGTCCAAAATCCAGCGGG + Intergenic
1042605531 8:70541993-70542015 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1042635347 8:70867963-70867985 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1043033492 8:75168638-75168660 ATGCAAGTTCAAAACCCAGCAGG + Intergenic
1043065649 8:75567453-75567475 ATGCAAGTCCAAAACCAGGCAGG + Intergenic
1043080675 8:75761206-75761228 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1043518631 8:81020035-81020057 ATGCAAGTCCAAAATTCAATAGG - Intronic
1043623842 8:82230189-82230211 ATGCAAGTCGAAAACCCAGCAGG - Intergenic
1043660685 8:82736578-82736600 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1043694827 8:83205004-83205026 ATGCAATTCCAAAATTCAGTGGG - Intergenic
1043805827 8:84671109-84671131 ATGCAAGTCCAAAATCCAGCAGG + Intronic
1043879897 8:85530463-85530485 CTGCAATTCCAAAACAGTGATGG + Intergenic
1044029227 8:87213968-87213990 ATGCAAGTCCAAAATGCAGCTGG + Intronic
1044087126 8:87955399-87955421 ATGCAAGTCCGAAATCCAGAGGG + Intergenic
1044433136 8:92132309-92132331 ATGCAAGTCCAAAACGCAGCAGG + Intergenic
1044504612 8:93003816-93003838 ATGCAAATTCAAAACTCAGCAGG + Intronic
1044652664 8:94514047-94514069 CTGCAATTCCAAAACCAAGATGG + Intronic
1044851513 8:96433086-96433108 ATGCAAGTCCAAAATGCAGTGGG - Intergenic
1044887375 8:96793841-96793863 ATGCAAGTCCAAAATCCAGCAGG + Intronic
1045050421 8:98319572-98319594 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1045207494 8:100057131-100057153 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1045436937 8:102173236-102173258 ATGCAAGTTCAAAATTCAGTAGG + Intergenic
1045785823 8:105919038-105919060 ATGCAAGTCCAAAATATAGCAGG - Intergenic
1045880389 8:107030993-107031015 ATGCAAGTCCAAAAACCAGCAGG - Intergenic
1045993651 8:108338859-108338881 ATGCAAGTCCAAAACCCAGTGGG + Intronic
1046180082 8:110633618-110633640 ATGCAAGTCCAAAATTCAATAGG - Intergenic
1046235962 8:111424274-111424296 ATGCAAGTCCAAAATCCAGGAGG - Intergenic
1046243692 8:111531721-111531743 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1046267161 8:111846107-111846129 ATGTAAGTTCAAAACCCAGAAGG + Intergenic
1046433062 8:114153429-114153451 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1046481178 8:114821021-114821043 ATGCAAGTCCAAAACCTAAGAGG + Intergenic
1046492273 8:114968220-114968242 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1046495564 8:115009874-115009896 ATGCAAGTCCAAAATATAGCAGG + Intergenic
1046877979 8:119277368-119277390 ATGCAAGTTCAAAACTCAGCAGG + Intergenic
1047030937 8:120879944-120879966 ATCCAAGTAAAAAACTCAGATGG - Intergenic
1047565658 8:126040947-126040969 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1047649098 8:126900475-126900497 ATGCAAGTCCAAAACTTGGCAGG - Intergenic
1047865936 8:129024220-129024242 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1047917977 8:129603436-129603458 ATGCAAGTCCAAAACCCAGGAGG + Intergenic
1047937669 8:129798211-129798233 ATGCAAGACCAAAACCCAGCAGG + Intergenic
1048019007 8:130521144-130521166 ATGGAAGACCAAAAGTGAAATGG + Intergenic
1048130637 8:131693440-131693462 ATGCAAGTCCAAAACACAGCAGG + Intergenic
1048729117 8:137418396-137418418 ATGCAAGTCCAAAAGCCAAAAGG + Intergenic
1048745961 8:137615412-137615434 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1049076379 8:140399539-140399561 ATGTAAGTCCGAAACCCAGAGGG - Intronic
1050109461 9:2199970-2199992 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1050849378 9:10264485-10264507 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1050894696 9:10872304-10872326 ATGCAAGTCCAAAATCTAGCAGG + Intergenic
1051128779 9:13835652-13835674 ATGCAAGTCCAAAATTCAGCAGG - Intergenic
1051743817 9:20276319-20276341 ATGCAAGTCCAAAATCCAGCTGG + Intergenic
1051915112 9:22198681-22198703 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1051925278 9:22317453-22317475 ATGCAAGTCTGAAACCCAGAAGG - Intergenic
1051946303 9:22573432-22573454 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1051975354 9:22941843-22941865 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1052179303 9:25505154-25505176 ATGCAAGTCCAAAACCCACCAGG + Intergenic
1052217996 9:25989940-25989962 ATGCAAGTCCAAAATTTAGAGGG + Intergenic
1052522288 9:29563371-29563393 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1052570489 9:30215215-30215237 ATTCAGGTGGAAAACTGAGATGG + Intergenic
1052689784 9:31802420-31802442 ATGCAAATCCAAAACCCAGCAGG - Intergenic
1052702130 9:31950298-31950320 ATGCAAGTCCAAAACACAGCAGG + Intergenic
1052846337 9:33339803-33339825 ATGCAAGTCCGAAATTCAGTGGG + Intronic
1052878726 9:33586923-33586945 ATGCAAGTCAAAAACCTAGCAGG - Intergenic
1052879597 9:33593121-33593143 ATGCAAGTCAAAAACCCAGCAGG - Intergenic
1052880131 9:33596730-33596752 ATGCAAGTCCAAAACCCAGGAGG - Intergenic
1053264168 9:36698536-36698558 ATGCAAGTCCAAAACCCAACAGG + Intergenic
1053495845 9:38547488-38547510 ATGCAAGTCCAAAACCCAGGAGG + Intronic
1053496384 9:38551111-38551133 ATGCAAGTCAAAAACCCAGCAGG + Intronic
1053496818 9:38554209-38554231 ATGCAAGTCAAAAACCCAGCAGG + Intronic
1053497251 9:38557286-38557308 ATGCAAGTCAAAAACCTAGCAGG + Intronic
1053641586 9:40087809-40087831 ATGCAAGTCCGAAATCCAGAGGG + Intergenic
1053663583 9:40301532-40301554 ACACAAGTCCAAAACCCAGAAGG - Intronic
1053664076 9:40305290-40305312 ACACAAGTCCAAAACTCAGCGGG - Intronic
1053665042 9:40311495-40311517 ACACAAGTCCAAAACTCAGCGGG - Intronic
1053665455 9:40314432-40314454 ATGCAAGTCCAAAACCCAGCAGG - Intronic
1053665930 9:40317520-40317542 ATGCAAGTCCAAAACCCAGGAGG - Intronic
1053666268 9:40320007-40320029 ATGCAAGTCAAAAACCCAGCAGG - Intronic
1053720922 9:40946008-40946030 ATGCAAGTCCAAAATTCAATGGG + Intergenic
1053764549 9:41377655-41377677 ATGCAAGTCCGAAATCCAGAGGG - Intergenic
1053914096 9:42932074-42932096 ATGCAAGTCCAAAACCCAGAAGG - Intergenic
1053914624 9:42936545-42936567 ACACAAGTCCAAAACTCAGCGGG - Intergenic
1053915047 9:42939479-42939501 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1053915508 9:42942565-42942587 ATGCAAGTCCAAAACCCAGGAGG - Intergenic
1053915848 9:42945054-42945076 ATGCAAGTCAAAAACCCAGCAGG - Intergenic
1054322474 9:63685198-63685220 ATGCAAGTCCGAAATCCAGAGGG + Intergenic
1054345071 9:63906148-63906170 ATGCAAGTCCAAAATTCAATGGG - Intergenic
1054376203 9:64451525-64451547 ACACAAGTCCAAAACTCAGCGGG - Intergenic
1054376608 9:64454462-64454484 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1054377084 9:64457548-64457570 ATGCAAGTCCAAAACCCAGGAGG - Intergenic
1054377421 9:64460035-64460057 ATGCAAGTCAAAAACCCAGCAGG - Intergenic
1054518341 9:66056276-66056298 ATGCAAGTCAAAAACCCAGCAGG + Intergenic
1054518681 9:66058763-66058785 ATGCAAGTCCAAAACCCAGGAGG + Intergenic
1054519160 9:66061852-66061874 ATGGAAGTCCAAAACCCAGCAGG + Intergenic
1054519573 9:66064789-66064811 ACACAAGTCCAAAACTCAGCGGG + Intergenic
1054520539 9:66070995-66071017 ACACAAGTCCAAAACTCAGCGGG + Intergenic
1054521032 9:66074753-66074775 ACACAAGTCCAAAACCCAGAAGG + Intergenic
1054543165 9:66288832-66288854 ATGCAAGTCCAAAATCCAGAGGG - Intergenic
1054909313 9:70439320-70439342 ATAAGAGTCCAAAACAGAGATGG + Intergenic
1055225422 9:73989528-73989550 ATGCAAGTCCAAAATCCAGGTGG + Intergenic
1055264195 9:74476354-74476376 AAGCAAGTCCAAAATTCAGTGGG - Intergenic
1055334907 9:75223849-75223871 ATGCAAGTCCAAAACCCAGAAGG + Intergenic
1055364051 9:75525268-75525290 ATGCAAGTCCAAAATCTAGTGGG - Intergenic
1055579227 9:77690643-77690665 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1055698717 9:78917708-78917730 ATGCAAGTCCAAAACCTGGCAGG - Intergenic
1055701350 9:78948609-78948631 ATGCAAGTCCAAAATCCAAAGGG - Intergenic
1056434896 9:86566269-86566291 ATGCAAGTCCAAAACCCAGATGG + Intergenic
1056527201 9:87454638-87454660 ATGCAAGTCTAAAACCCAGCAGG + Intergenic
1056585956 9:87927303-87927325 ATGCAAGTCCAAAACCCAGGAGG + Intergenic
1056610928 9:88125640-88125662 ATGCAAGTCCAAAACCCAGGAGG - Intergenic
1056687158 9:88776198-88776220 AGGCAAGTCCCAGGCTGAGAAGG + Intergenic
1057316391 9:93971575-93971597 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1057369261 9:94455114-94455136 ATGAAATTCCAAAATTCAGAAGG - Intronic
1057675773 9:97135007-97135029 ATACAAGTCCAAAACCCAGAAGG + Intergenic
1057676300 9:97138650-97138672 ATGCAAGTCAAAAACCCAGCAGG + Intergenic
1057945463 9:99324217-99324239 GTGACAGTCCCAAACTGAGATGG + Intergenic
1058076601 9:100657678-100657700 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1058174605 9:101722689-101722711 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1058181803 9:101808219-101808241 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1058380509 9:104372241-104372263 ATGCAAGTCCGAAATTCAGCAGG - Intergenic
1058385429 9:104429867-104429889 ATGCAAATCCAAAACCCAGCAGG - Intergenic
1058813138 9:108660246-108660268 ATGCAAGTTCAAAACCCAGCAGG - Intergenic
1058831669 9:108823381-108823403 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1059110681 9:111556138-111556160 ATGCAAGTCCAAAACCTGGTGGG + Intronic
1059195784 9:112369475-112369497 ATGCAAGTCCAAAATCCAGAGGG - Intergenic
1059658545 9:116378639-116378661 ATGGAATGCCAAAACTGGGAAGG + Intronic
1059737514 9:117117122-117117144 AGGCAAGTGAAAAACAGAGAGGG + Intronic
1059917376 9:119118354-119118376 ATGCAAGTCTGAAACTCAGCAGG - Intergenic
1059986361 9:119824102-119824124 ATGCAAGTCCAAAATCCAGGGGG - Intergenic
1060005865 9:119998782-119998804 ATGCAAGTGTACAGCTGAGAGGG - Intergenic
1060261323 9:122076440-122076462 AGGCAAGGCCAAAACACAGAAGG - Intronic
1060348466 9:122837240-122837262 ATGCAAGTCTGAAACTCAGCAGG + Intergenic
1060622784 9:125082732-125082754 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1061806495 9:133140243-133140265 ATGTAAGTTCAAAACTGGGAGGG - Intronic
1062161081 9:135080278-135080300 CAGCAAGTCCAAAACAGAGGGGG - Intronic
1062740074 9:138167204-138167226 ATGCAAGTCTGAAACCCAGAAGG - Intergenic
1203462299 Un_GL000220v1:52608-52630 ATGCACGACCAGACCTGAGACGG + Intergenic
1203545260 Un_KI270743v1:123423-123445 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1203545320 Un_KI270743v1:123856-123878 ATGCAAGTCAAAAACCCAGCAGG + Intergenic
1203546143 Un_KI270743v1:129794-129816 ATGCAAGTCCAAAACCCAGGAGG + Intergenic
1203635366 Un_KI270750v1:105755-105777 ATGCAAGTCCAAAATGCAGCAGG + Intergenic
1185815811 X:3154207-3154229 ATGCAAGTCTGAAACTCAGCAGG + Intergenic
1186165224 X:6820606-6820628 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1186222793 X:7367081-7367103 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1186266557 X:7840195-7840217 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1186699457 X:12074262-12074284 CTCCAACTCCAAAATTGAGAAGG + Intergenic
1186954664 X:14669113-14669135 ATGCAAGTCCAAAATTCAGCAGG + Intronic
1186980707 X:14954839-14954861 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1187598481 X:20800653-20800675 ATGCAAGTCCAAAATACAGCAGG - Intergenic
1187603834 X:20861874-20861896 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1187667325 X:21628108-21628130 ATGCAAGTCCAAAATCCAGCAGG + Intronic
1187843257 X:23510103-23510125 ATGCAAGTCTAAAACCCAGCAGG - Intergenic
1188124441 X:26350928-26350950 ATGCAAGTCCAAAATGCAGTGGG + Intergenic
1188127178 X:26383672-26383694 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1188259631 X:28007811-28007833 ATGCAAGTCCAAAACTCGGCAGG + Intergenic
1188325454 X:28796523-28796545 ATGCAAGTCCAAAATCTAGCAGG + Intronic
1188449650 X:30295475-30295497 GTGCAAGTCCAAAATTCAAATGG - Intergenic
1188657686 X:32717887-32717909 GTGCAAGTCCAAAACCCAGCAGG - Intronic
1188719610 X:33506367-33506389 ATGCAAGTCCAAAATTGAATAGG - Intergenic
1188807777 X:34613341-34613363 ATGCAAGTCCAAAACCTAGCGGG + Intergenic
1188833332 X:34928017-34928039 ATGCAAGTCCGAAACCCAGCAGG + Intergenic
1188926612 X:36051481-36051503 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1188964803 X:36537594-36537616 ATGCAAGTCCAAAACCAAGCAGG - Intergenic
1188982831 X:36742734-36742756 ATGCAAGTCCAAAACTCATCAGG + Intergenic
1189011873 X:37053886-37053908 ATGCAAGTTCAAAACCCAGCAGG - Intergenic
1189036833 X:37502401-37502423 ATGCAAGTTCAAAACCCAGCAGG + Intronic
1189435660 X:40990672-40990694 ATGCAAGTCCAAAACCAGCAGGG + Intergenic
1189652837 X:43208587-43208609 ATGCAAGTCCAAAACCCAACAGG - Intergenic
1189669673 X:43394809-43394831 ATGCAAGTCCAAAATTCAGCAGG + Intergenic
1189815849 X:44823488-44823510 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1190513213 X:51195248-51195270 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1190703519 X:53006113-53006135 AAGCAAGTCCAAAACCCAGCAGG + Intergenic
1191083983 X:56545224-56545246 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1191095144 X:56665695-56665717 ATGCAAGTCCAAAATCCAGAAGG - Intergenic
1191170985 X:57447126-57447148 ATGCAAGTCCAAAATCCAGTGGG + Intronic
1191689840 X:63928167-63928189 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1191760961 X:64647596-64647618 ATGCAAGTCTAAAACCAAGCAGG - Intergenic
1191802211 X:65093611-65093633 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1191873414 X:65769566-65769588 ATGCAAGTCCATAACCCAGCAGG - Intergenic
1191887043 X:65899387-65899409 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1192071026 X:67941415-67941437 ATGCAAGTTCAAAACCCAGCAGG + Intergenic
1192279025 X:69663889-69663911 ATGCAAGTCCAAAATCTAGCAGG - Intronic
1192745553 X:73934937-73934959 ATGCAAGTCCAAAATCCATAGGG - Intergenic
1192887224 X:75348096-75348118 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1193029044 X:76878605-76878627 ATGCAAGTCCAAAACCCAGAAGG + Intergenic
1193043063 X:77024212-77024234 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1193143459 X:78053981-78054003 ATGCAAATCCAAAACTCAGCAGG + Intergenic
1193175514 X:78388220-78388242 ATGCAAGTCCAAAACTCATAAGG + Intergenic
1193183217 X:78483048-78483070 ATGCAAGTCCAAAATTGAGCAGG + Intergenic
1193333011 X:80256497-80256519 ATGCAAGTCCATAACCCAGTGGG - Intergenic
1193449255 X:81645772-81645794 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1193485157 X:82078391-82078413 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1193501038 X:82275415-82275437 ATACAAGTCCAAAATTGAGCAGG + Intergenic
1193503485 X:82309771-82309793 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1193519521 X:82511929-82511951 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1193686303 X:84580605-84580627 ATGCAAGTCCAAAACCCAATAGG - Intergenic
1193758425 X:85436836-85436858 ATGCAAGTCTGAAACTAAGAAGG - Intergenic
1193795368 X:85866797-85866819 ATGCAAGTCCAAAACCCAGCCGG - Intronic
1193930071 X:87542548-87542570 ATGCATGTCCAAAACACAGCTGG - Intronic
1193965213 X:87976370-87976392 ATGCAAGACCAAAACCCAGCAGG - Intergenic
1193981414 X:88185939-88185961 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1194064255 X:89242042-89242064 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1194084113 X:89505321-89505343 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1194145243 X:90254433-90254455 ATGCAAGTCCAAAATCTAGCAGG + Intergenic
1194192850 X:90858328-90858350 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1194215726 X:91128522-91128544 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1194216459 X:91135221-91135243 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1194244294 X:91492841-91492863 ATGCATGTCCAAAACCAAGCAGG + Intergenic
1194281775 X:91962355-91962377 ATGCAAGTCCAAAATCCAGTGGG + Intronic
1194300662 X:92182212-92182234 ATGCAAGTCCAAAATCCAGCAGG - Intronic
1194302890 X:92209414-92209436 ACGCAAGTCCAAAACCCAGCAGG + Intronic
1194321196 X:92447971-92447993 ATGGAGGTCCAAAACTCAGCAGG - Intronic
1194484581 X:94471678-94471700 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1194500161 X:94672638-94672660 ATGCAAGCCCAAAACTTGGCAGG + Intergenic
1194503741 X:94708154-94708176 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1194541532 X:95178169-95178191 ATGCAAGTCTGAAACACAGAAGG - Intergenic
1194563047 X:95446939-95446961 ATGCAAGTCCAAAACCCAGCTGG + Intergenic
1194784209 X:98062434-98062456 ATGCAAGTCTAAAACCCAGCAGG + Intergenic
1194855203 X:98919190-98919212 ATGAAAGTCCAAAACCCAGCAGG - Intergenic
1194864981 X:99054351-99054373 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1194895350 X:99432994-99433016 ATGCAAGTCTAAAACCCAGCAGG - Intergenic
1194982399 X:100453723-100453745 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1195035181 X:100965666-100965688 AAGCAAGTCCAAAACCCAGCAGG - Intergenic
1195130344 X:101844804-101844826 ATGAAAGTCCATAAATGAAAGGG + Intronic
1195175924 X:102315446-102315468 ATGAAAGTCCATAAATGAAAGGG - Intronic
1195182940 X:102371647-102371669 ATGAAAGTCCATAAATGAAAGGG + Intronic
1195428444 X:104761768-104761790 ATGCAAGTCCAAAATCCAGCAGG + Intronic
1195814147 X:108867286-108867308 ATGCAAGTCCAAAACCCAGCAGG + Intergenic
1195823628 X:108973196-108973218 ATGCAAGTCCAAAATCCAGAAGG - Intergenic
1196036306 X:111149106-111149128 ATGCAAGTCCAAAATCCAGCAGG + Intronic
1196526002 X:116727637-116727659 ATACAAGTCCAAAATCCAGAAGG - Intergenic
1196559380 X:117127080-117127102 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1196565292 X:117197323-117197345 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1196601504 X:117606032-117606054 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1196903454 X:120409500-120409522 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1196973805 X:121137512-121137534 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1197056609 X:122128404-122128426 ATGCAAATCCAAAACTCAGAAGG + Intergenic
1197056635 X:122128617-122128639 ATGCAAATCCAAAACTCAGAAGG - Intergenic
1197074680 X:122340631-122340653 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1197349718 X:125369460-125369482 ATGCAAGTCCAAAATTCTGTAGG + Intergenic
1197372855 X:125646261-125646283 ATGCAAGTCCTAAACCCAGCAGG + Intergenic
1197441355 X:126494813-126494835 ATGCAAGTCCAAAATCCAGTGGG - Intergenic
1197551981 X:127902403-127902425 ATGCAAGTCCAAAGCCCAGCAGG - Intergenic
1197583134 X:128310483-128310505 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1197639695 X:128954353-128954375 ATACAAGTCCAAAATTCAGCAGG + Intergenic
1197640205 X:128959251-128959273 ATGCAAGTCCAAAACCAGCAGGG + Intergenic
1197798144 X:130319592-130319614 ATGCAGGTCCAAAATTCAGCAGG - Intergenic
1198497084 X:137203780-137203802 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1198804801 X:140483660-140483682 ATGCAAGCCCAGAAAGGAGAAGG - Intergenic
1198919281 X:141707900-141707922 ATGCAAGTCCAAAATCAAGTAGG + Intergenic
1198972981 X:142302379-142302401 ATGCAAGTCCTAAACCCAGCAGG + Intergenic
1198972988 X:142302435-142302457 ATGCAAGTCCTAAACCCAGCAGG + Intergenic
1198996437 X:142578812-142578834 ATGCAAGTCTAAAATTCAGCAGG - Intergenic
1199063682 X:143389177-143389199 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1199078678 X:143552096-143552118 ATGCAAATCCAAAACCCAGCAGG - Intergenic
1199083773 X:143606355-143606377 ATGCAAGTCCAAAACCCAGTGGG - Intergenic
1199141489 X:144318989-144319011 CTGCAAGTCCAAAAATATGAAGG + Intergenic
1199147127 X:144381271-144381293 ATGCAAGTCCAAAATCTAGCAGG - Intergenic
1199200931 X:145088191-145088213 ATGCAAGTCCAAAATTAGGCTGG - Intergenic
1199203787 X:145124107-145124129 ATGCAAGTCCAAAATCCAGCAGG + Intergenic
1199309977 X:146311033-146311055 ATCCAAGTCCAAAATTCAGCAGG + Intergenic
1199325556 X:146494098-146494120 ACGCAAGTCCAAAATTCAGTGGG - Intergenic
1199373842 X:147083899-147083921 ATGCAAGTCTGAAACTCAGCAGG - Intergenic
1199480986 X:148298131-148298153 ATGCAAGTCCAAAATCCAGCAGG - Intergenic
1199515183 X:148668106-148668128 ATGCAAGTCCAAAATCCAGCAGG + Intronic
1199585609 X:149412992-149413014 ATGCAAGTTCAAAACTCAGCAGG - Intergenic
1199806416 X:151305194-151305216 ATGCAAGTCCAAAACCCAGTAGG + Intergenic
1200255800 X:154582113-154582135 ATGCAAGTCCAAAACCCAACAGG - Intergenic
1200261969 X:154622290-154622312 ATGCAAGTCCAAAACCCAACAGG + Intergenic
1200389206 X:155926726-155926748 AGGCATGTCGAAAGCTGAGATGG - Intronic
1200436756 Y:3161207-3161229 ATGCAAGTCCAAAATCCAGTGGG + Intergenic
1200491004 Y:3823728-3823750 ATGCAAGTCCAAAATCTAGCAGG + Intergenic
1200563274 Y:4734139-4734161 ATGCATGTCCAAAACCAAGCAGG + Intergenic
1200599369 Y:5187008-5187030 ATGCAAGTCCAAAATCCAGTGGG + Intronic
1200629313 Y:5561118-5561140 ATGGAGGTCCAAAACTCAGCAGG - Intronic
1200718428 Y:6576141-6576163 ATGCAAGTCCAAAACCCAGCAGG - Intergenic
1201185624 Y:11399698-11399720 AAGCAAGTTCAAAACTCAGCAGG + Intergenic
1201265559 Y:12203313-12203335 ATGCAAGTCTGAAACTTAGCAGG - Intergenic
1201589960 Y:15603998-15604020 ATGCAAGTCCAAAATTCAGTAGG + Intergenic
1201921648 Y:19240184-19240206 ATGAAAGTCCAAAACCCAGCAGG - Intergenic
1202099275 Y:21288644-21288666 CTGCAAGTCCAAAACACAGCCGG - Intergenic