ID: 986602069

View in Genome Browser
Species Human (GRCh38)
Location 5:9482460-9482482
Sequence CTGGGTGAGTGGAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1106
Summary {0: 1, 1: 0, 2: 10, 3: 103, 4: 992}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986602063_986602069 -7 Left 986602063 5:9482444-9482466 CCTAAAGGCCAAGATTCTGGGTG 0: 1
1: 0
2: 0
3: 16
4: 211
Right 986602069 5:9482460-9482482 CTGGGTGAGTGGAAGGTGGGAGG 0: 1
1: 0
2: 10
3: 103
4: 992
986602059_986602069 8 Left 986602059 5:9482429-9482451 CCTAGAGTGAGCATACCTAAAGG 0: 1
1: 0
2: 1
3: 7
4: 106
Right 986602069 5:9482460-9482482 CTGGGTGAGTGGAAGGTGGGAGG 0: 1
1: 0
2: 10
3: 103
4: 992

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986602069 Original CRISPR CTGGGTGAGTGGAAGGTGGG AGG Intronic
900088220 1:908665-908687 GGGGATGAGGGGAAGGTGGGAGG + Intergenic
900363014 1:2298990-2299012 CTGGGTGGGTGGATGCCGGGTGG + Intronic
900509341 1:3051200-3051222 ATGGGTGAGTGGATGGTGGGTGG - Intergenic
900605679 1:3522582-3522604 CCGGGTGAGTGATGGGTGGGTGG + Intronic
900637475 1:3672984-3673006 CTGGGTATGAGGAGGGTGGGTGG - Intronic
900763768 1:4489706-4489728 CTGGGTGGCTGGAAGGCAGGGGG + Intergenic
901006675 1:6175066-6175088 ATGGATGAGTGGATGGTGGATGG + Intronic
901006702 1:6175199-6175221 ATGGATGAGTGGATGGTGGTTGG + Intronic
901006731 1:6175341-6175363 ATGGATGAGTGGATGGTGGATGG + Intronic
901100416 1:6715267-6715289 CTGGGAGGGAGGGAGGTGGGGGG - Intergenic
901220895 1:7583222-7583244 GGGGGTGTGTGGAAGGAGGGAGG + Intronic
901225899 1:7612849-7612871 TTGGGTGAGAGGAAGGCGGTGGG + Intronic
901626567 1:10628381-10628403 CTGGGTGAGTGGGAGGGTGCAGG + Intronic
901646713 1:10720805-10720827 GAGGGTGAGTGGAAGCTGGAGGG + Intronic
901960857 1:12825543-12825565 AGGGGTGAGTGGAGGGTGGTGGG + Intronic
901967452 1:12880145-12880167 AGGGGTGAGTGGAGGGTGGTGGG + Intronic
901975251 1:12939276-12939298 AGGGGTGAGTGGAGGGTGGTGGG + Intronic
901982853 1:13050409-13050431 AGGGGTGAGTGGAGGGTGGTGGG + Intronic
901986168 1:13076929-13076951 AGGGGTGAGTGGAGGGTGGTGGG - Intronic
901995642 1:13149838-13149860 AGGGGTGAGTGGAGGGTGGTGGG + Intergenic
901999236 1:13178509-13178531 AGGGGTGAGTGGAGGGTGGTGGG - Intergenic
902009924 1:13262488-13262510 AGGGGTGAGTGGAGGGTGGTGGG - Intronic
902017721 1:13321641-13321663 AGGGGTGAGTGGAGGGTGGTGGG - Intronic
902030782 1:13420635-13420657 AGGGGTGAGTGGAGGGTGGTAGG - Intronic
902266161 1:15266751-15266773 AGGGGTCAGGGGAAGGTGGGGGG - Intronic
902378052 1:16039506-16039528 ATGGCTGAGTTGCAGGTGGGAGG - Intergenic
902383141 1:16062002-16062024 ATGGCTGAGTTGCAGGTGGGAGG - Intronic
902721448 1:18306942-18306964 CTGGGTTCCTGGAAGGTGGCAGG - Intronic
902810225 1:18883851-18883873 CTCGGTGTGTGGGAGGTGGATGG + Intronic
903050020 1:20593816-20593838 CTGTGTGAGGCCAAGGTGGGAGG - Intronic
903243572 1:21999915-21999937 CTGGGTTCGTGGAACGTGTGTGG - Intergenic
903280851 1:22249033-22249055 CTGGGTGTGGGGCAGGGGGGAGG + Intergenic
903360825 1:22775979-22776001 TTGGCAGAGTGGGAGGTGGGTGG + Intronic
903421126 1:23218201-23218223 CTGGATGAATGGAAGGGGGCGGG + Intergenic
903858501 1:26351313-26351335 CTCGGAGAGTGGAAGGCAGGTGG - Intronic
904011605 1:27393217-27393239 CTGGGAGGGTGGGGGGTGGGGGG + Intronic
904438514 1:30514932-30514954 CTGAGTGGATGGAAGGTTGGGGG - Intergenic
904741939 1:32684200-32684222 CTGGCTGAGGGGATGGTGGGAGG - Exonic
904774434 1:32898092-32898114 CTGGGAGGGTGGTTGGTGGGAGG - Intronic
904842147 1:33379455-33379477 GTGGGTGGGGGGATGGTGGGGGG - Intronic
904947311 1:34208860-34208882 GTTGGCCAGTGGAAGGTGGGTGG - Intronic
905035880 1:34918215-34918237 CTGTGTCAGTGGATGGTGGCAGG - Intronic
905241281 1:36583185-36583207 GTGGGTGAGTGGTGGGTAGGTGG - Intergenic
905519898 1:38589606-38589628 CTGGGGGAGTGGAGGGTGTAGGG - Intergenic
906316155 1:44787488-44787510 TTGGGTTAGAGGGAGGTGGGTGG + Intronic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906569494 1:46824411-46824433 ATTGGTGGGTGGAGGGTGGGAGG + Intergenic
906640162 1:47436956-47436978 CTGGGAGCCAGGAAGGTGGGGGG + Exonic
906728960 1:48064825-48064847 GTGGATGAGTGGATGGAGGGAGG - Intergenic
906728977 1:48064897-48064919 GTGGATGAGTGGATGGAGGGAGG - Intergenic
907309200 1:53529726-53529748 CTGAATGAGTGGCAGGTGTGTGG + Intronic
907310200 1:53534693-53534715 GTGCGTGAGTGGAAGGATGGGGG - Intronic
907393054 1:54171187-54171209 GTGGGAGATCGGAAGGTGGGAGG + Intronic
907840317 1:58150833-58150855 TGGGGTGAGGGGACGGTGGGGGG - Intronic
908438218 1:64127970-64127992 TTGGAAGAGTGGAAGGTTGGAGG + Intronic
908444238 1:64186888-64186910 GTGGGTGAGTGGCAGGTAGCTGG - Intergenic
908445162 1:64192707-64192729 GTGGGTGAGTGGTAGGTAGCTGG - Intergenic
908500330 1:64737189-64737211 CTGGGTGAGTGAGTGATGGGAGG - Intergenic
908603594 1:65768247-65768269 ATGGGAGGGTGGAAGGTGGGAGG - Intergenic
908743519 1:67353323-67353345 CTTTGGGAGTGCAAGGTGGGAGG + Intronic
909030319 1:70531502-70531524 CAGATTGAGTGGGAGGTGGGAGG + Intergenic
909392246 1:75131618-75131640 TCGGGTGAGTGGAAGCTGTGGGG + Intronic
909431974 1:75598770-75598792 ATTGAAGAGTGGAAGGTGGGAGG + Intronic
911347407 1:96713665-96713687 TTAGGAGAGTGGAGGGTGGGAGG - Intergenic
911521822 1:98938969-98938991 ATTGGAGAGTGGAGGGTGGGAGG + Intronic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
913301657 1:117376537-117376559 GTGGGTGAGTGGCAGGTAGTTGG - Intronic
913331009 1:117667775-117667797 AGGGGTGAGTAGAAGTTGGGAGG - Intergenic
913441248 1:118900224-118900246 CAAGGTCACTGGAAGGTGGGTGG + Intronic
913486663 1:119337826-119337848 CTGTGTTGGTTGAAGGTGGGTGG + Intergenic
914880588 1:151543643-151543665 CTGGGTAAGTGGAACGATGGAGG + Intronic
914942101 1:152032460-152032482 ATGGGAGGGTGGAAAGTGGGAGG - Intergenic
915170281 1:153972814-153972836 CTTGGTGAGGGGCAGGTGAGAGG - Exonic
916736498 1:167612024-167612046 CTGGGGGAGTGAAAGGGAGGAGG - Intergenic
917979436 1:180259935-180259957 CTGGGGGAGTGAGCGGTGGGAGG + Intronic
918171733 1:182004062-182004084 CTGGCTGTGTGGGAGCTGGGTGG + Intergenic
918249937 1:182693965-182693987 ATTTGAGAGTGGAAGGTGGGAGG + Intergenic
918349023 1:183635263-183635285 CTGGGGGCGTGGAAGGCGCGCGG + Intronic
918465432 1:184817017-184817039 CAGGGTGAGGGGCAGGTGGAGGG - Intronic
918528931 1:185496080-185496102 CTGGCTGAGATGAAGGTGGTGGG + Intergenic
919202396 1:194372715-194372737 ATGGGAGAGTGGAGGGTGGCAGG - Intergenic
919604652 1:199667061-199667083 GTGGGTGAGTGGCAGGTAGCTGG + Intergenic
919640479 1:200040397-200040419 CTGAGTGAGTTGGGGGTGGGAGG + Intronic
920295619 1:204954421-204954443 CTGGGTAAATGGAGAGTGGGGGG + Intronic
920343151 1:205288374-205288396 CCGGGTGAGTGAAGGGTGGGTGG - Intergenic
920825874 1:209423856-209423878 CTGGGTGAGGGGGAGGTGTGGGG + Intergenic
920837425 1:209524572-209524594 CTGGGAGAGTGGAGGGAAGGGGG + Intergenic
921349737 1:214223289-214223311 CATGGAGAGTGGAAGGAGGGTGG - Intergenic
921458939 1:215405998-215406020 TTTGGAGAGTGGAGGGTGGGAGG + Intergenic
921601576 1:217111739-217111761 CTGGGAGAGTGGTAGTTGGGAGG + Intronic
921939619 1:220826607-220826629 CTGGGTGGGAAGGAGGTGGGCGG + Intergenic
921986210 1:221315627-221315649 AAGGGGGAGTGGATGGTGGGTGG + Intergenic
922479740 1:225931240-225931262 CTTGGGGAGAGGGAGGTGGGAGG + Intergenic
922618780 1:226978338-226978360 TCGGGTGGGTGGAGGGTGGGTGG - Intronic
923482446 1:234397454-234397476 ATGGGGGAGGGGAAGGAGGGAGG + Intronic
924172667 1:241357516-241357538 GTGGGTGGGTGGTAGGTGGGTGG + Intergenic
1062799865 10:371138-371160 CAGGGTGAGGGGATGGTGGCAGG - Intronic
1062812534 10:477448-477470 GTGGATGGGTGGGAGGTGGGAGG + Intronic
1062812548 10:477482-477504 GTGGATGGGTGGGAGGTGGGAGG + Intronic
1062812591 10:477609-477631 ATGGGTGGGAGGAAGGTGGATGG + Intronic
1063738589 10:8791644-8791666 ATTGGAGGGTGGAAGGTGGGAGG - Intergenic
1063753324 10:8977012-8977034 CTGGGGATGTGGAAGGAGGGGGG + Intergenic
1063958032 10:11283805-11283827 GTGGATGGGTGGATGGTGGGTGG + Intronic
1064146941 10:12833252-12833274 CTGGATGAATCGTAGGTGGGAGG + Exonic
1064442218 10:15364038-15364060 TCGGGTGGGTGGAGGGTGGGGGG + Intronic
1066076291 10:31881032-31881054 ATGGAGGAGGGGAAGGTGGGGGG - Intronic
1066299641 10:34085657-34085679 CTGGAAGCCTGGAAGGTGGGAGG + Intergenic
1066370562 10:34815321-34815343 CTGGGGGAGGGGACGGCGGGAGG + Exonic
1067089164 10:43257873-43257895 CTGGCTGCCTGGATGGTGGGAGG - Intronic
1067435723 10:46275128-46275150 CTGGGTTAGTGGACTTTGGGGGG + Intergenic
1067449908 10:46375869-46375891 CTGGGTAAGTGGGAGCTGGCAGG + Exonic
1067587338 10:47483894-47483916 CTGGGTAAGTGGGAGCTGGCAGG - Exonic
1067634397 10:47991661-47991683 CTGGGTAAGTGGGAGCTGGCAGG - Intergenic
1067786529 10:49253500-49253522 CTGGGTGGGAGGAAGGAGGAGGG + Intergenic
1068438184 10:57017705-57017727 CTGGTTGCCTTGAAGGTGGGCGG + Intergenic
1069623138 10:69850080-69850102 CTGGGTGAGCTGGAGGTGGAGGG + Intronic
1069711465 10:70491745-70491767 CTGGGGGAGGGGAAACTGGGAGG - Intronic
1069957490 10:72060965-72060987 CTGGGTGAGTGGTGGGTGTGGGG - Exonic
1070540048 10:77409315-77409337 CTGTGTGTGTGGTAGTTGGGTGG - Intronic
1070713439 10:78700281-78700303 CTGGGGGGGTGGGAGGTAGGGGG - Intergenic
1070862139 10:79679592-79679614 CTGGGAGGGTGGATGGTGGGAGG - Intergenic
1070874998 10:79794864-79794886 CTGGGAGGGTGGATGGTGGGAGG + Intergenic
1070976640 10:80610601-80610623 CTGGGTGAGAGGCAGGGGTGAGG - Intronic
1071601582 10:86961138-86961160 GTGGGTGGGTGGAAGGGTGGGGG + Intronic
1071629224 10:87204403-87204425 GTGGGAGGGGGGAAGGTGGGGGG + Intergenic
1071641922 10:87317029-87317051 CTGGGAGGGTGGATGGTGGGAGG + Intergenic
1072424781 10:95320785-95320807 AATGGTGAGTGGAAGGCGGGGGG - Intronic
1072479753 10:95799290-95799312 ATTGGAGGGTGGAAGGTGGGAGG - Intronic
1072631730 10:97151236-97151258 GTGGGTGAGTAGAAGATGGAAGG + Intronic
1072658246 10:97345732-97345754 CTGAGTGAGTGGGAGGGGTGTGG - Intergenic
1072965642 10:99970419-99970441 CCAGGTGCGTGGAATGTGGGTGG + Intronic
1073025780 10:100486427-100486449 CTGGGTGTGTTGAGGGTGGGGGG - Intergenic
1073098953 10:100997231-100997253 CTGGGTGAGTGGTGGGGCGGCGG + Intronic
1073338428 10:102727788-102727810 CTTGGTAAGTGGTAGGTTGGAGG + Intronic
1073477112 10:103761638-103761660 CTGTGTGGGTGGCAGGTGGCTGG - Intronic
1073482734 10:103797276-103797298 CTGTGAGAGAAGAAGGTGGGTGG + Intronic
1074094371 10:110296788-110296810 CTTGGGGCCTGGAAGGTGGGTGG - Intronic
1074204639 10:111272217-111272239 CTGGATGAGAGGAAGAGGGGAGG + Intergenic
1074208456 10:111305177-111305199 TTGGGGGAGGGGCAGGTGGGAGG + Intergenic
1074423257 10:113328057-113328079 AAGGGGGAGAGGAAGGTGGGAGG - Intergenic
1074491417 10:113942556-113942578 CAGTGGGAGTGGGAGGTGGGAGG - Intergenic
1074767893 10:116714032-116714054 ATGGGTGGGTGGATGGTGGGTGG + Intronic
1074850039 10:117432377-117432399 CTTGGTGGGTGCAGGGTGGGTGG - Intergenic
1074898897 10:117800272-117800294 CTGGGGGGGGGGGAGGTGGGGGG - Intergenic
1075136978 10:119794800-119794822 CTGGGAGGGAGGGAGGTGGGGGG - Intronic
1075618061 10:123905784-123905806 CTGGGTGAGGGTGGGGTGGGAGG - Intronic
1076007084 10:126956435-126956457 CTGAGTGAGTGGGAGGAGAGGGG + Intronic
1076029334 10:127144078-127144100 CTAGAGCAGTGGAAGGTGGGCGG - Intronic
1076135138 10:128040484-128040506 CAGGGCGAGTGGAGGGTGGATGG + Intronic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076371024 10:129953736-129953758 CTGGGTGGATGGAAGGTGCAAGG - Intronic
1076555290 10:131317554-131317576 ATTGGAGAGTGGAGGGTGGGAGG - Intergenic
1076867468 10:133175118-133175140 ATGGGTGGATGGATGGTGGGTGG + Intronic
1076910805 10:133388295-133388317 ATGGGAGAGTGGAGGATGGGAGG - Intronic
1076998923 11:312528-312550 AGGGGTGGGTGGAGGGTGGGGGG + Intronic
1077025218 11:436983-437005 GTGGGTGAGCGGGAGGTGAGCGG + Intronic
1077093658 11:790354-790376 GTGGGTGAGGGGTCGGTGGGTGG + Intergenic
1077327808 11:1971264-1971286 CTGTGTGGCTGGAAGGTGGAGGG - Intronic
1077354171 11:2107283-2107305 ATGGATGGGTGGATGGTGGGTGG + Intergenic
1077357811 11:2126851-2126873 GTGAGTGAGTGGTAAGTGGGTGG + Intergenic
1077373584 11:2194998-2195020 CTTGGTGGGTGGCAGGTGGCAGG + Intergenic
1077429227 11:2507776-2507798 CTGGGTGGGTGGAAGGGCAGAGG + Intronic
1077539932 11:3141784-3141806 CTGGGTGGGAGGCGGGTGGGGGG - Intronic
1077676255 11:4195497-4195519 CTGACTGAATGGAAGATGGGTGG - Intergenic
1078841778 11:15083303-15083325 ATTGGAGGGTGGAAGGTGGGAGG + Intergenic
1078857936 11:15221574-15221596 CTGGGTGACGGGCAGGTGTGGGG - Exonic
1079361013 11:19770387-19770409 CTGGGAGGGTGGGAGGAGGGAGG + Intronic
1079459243 11:20665575-20665597 ATGGGTTGGAGGAAGGTGGGAGG + Intergenic
1079641902 11:22816171-22816193 ATGGGGGAGGGGGAGGTGGGCGG - Intronic
1080225653 11:29957323-29957345 CTGGGGGAGTGGGAGGGAGGTGG - Intergenic
1080376890 11:31723339-31723361 CTGGGGGAGTGGGTGGCGGGGGG - Intronic
1081419101 11:42851170-42851192 TTTGGAGGGTGGAAGGTGGGAGG + Intergenic
1081504010 11:43695990-43696012 TTCGGAGGGTGGAAGGTGGGAGG - Intronic
1081521584 11:43886949-43886971 GTCGGTGGGTGGAGGGTGGGAGG + Intronic
1082054605 11:47803072-47803094 CTGGGGGAGGCCAAGGTGGGAGG + Intronic
1082065906 11:47900085-47900107 CTGGGTGAGTAGAGGCTGGGTGG + Intergenic
1082895660 11:58187527-58187549 GTTGGAGGGTGGAAGGTGGGAGG - Intergenic
1083015761 11:59452270-59452292 TTTGGAGAGTGGAGGGTGGGAGG - Intergenic
1083655867 11:64229369-64229391 CTGGGTCTTGGGAAGGTGGGTGG + Intronic
1083729435 11:64644803-64644825 CTGGGAGAGAGGAGGCTGGGAGG + Intronic
1084033741 11:66495540-66495562 CTGGGGGCGTGGAGGGTGGGTGG + Intronic
1084043180 11:66554513-66554535 CTGGGTCGGGGGGAGGTGGGAGG - Intronic
1084257417 11:67952604-67952626 GTGGGGGGGTGGAGGGTGGGGGG - Intergenic
1084358092 11:68652628-68652650 ATCAGTGAGTGGAAGCTGGGGGG + Intergenic
1084537278 11:69764560-69764582 CTGGGGGAGGGGTGGGTGGGGGG + Intergenic
1084610907 11:70202447-70202469 GTGGGCGTGTGGAGGGTGGGGGG - Intergenic
1084940890 11:72612686-72612708 ATGGGTGGGTGGATGGTGGGTGG + Intronic
1084981077 11:72829083-72829105 CTGGTCGGGTGGAAGGTGGAGGG - Intronic
1085068188 11:73517387-73517409 CTGCATGAGGGGAAGGGGGGTGG - Intronic
1085195384 11:74668644-74668666 CTGGGTGAGTAAGGGGTGGGTGG + Intronic
1085199263 11:74691858-74691880 CAGGGTGAGGGGAAGCAGGGTGG + Intergenic
1085416903 11:76324645-76324667 GTGGGTGGGTCGGAGGTGGGCGG + Intergenic
1085464267 11:76713481-76713503 GTGGGTGAGTGGTTGATGGGTGG + Intergenic
1085745690 11:79112493-79112515 TAGGGTGAGAGGTAGGTGGGTGG + Intronic
1086086604 11:82961836-82961858 ATTGGGGGGTGGAAGGTGGGAGG - Intronic
1087134829 11:94706134-94706156 CTGGGGAAGTGGAAGCAGGGAGG - Intergenic
1087235850 11:95717909-95717931 CTGGGTGAATAGAAGGTAGATGG - Intergenic
1088201339 11:107338561-107338583 GTCGGTGGGTGGGAGGTGGGAGG - Intronic
1088595000 11:111434886-111434908 CAGGATGAGTGAAAGGTGAGAGG - Intronic
1088736858 11:112734819-112734841 CTTGGAGTGAGGAAGGTGGGTGG + Intergenic
1089096589 11:115924912-115924934 TTGGGGGTGTGGAGGGTGGGAGG - Intergenic
1089200338 11:116720856-116720878 ATGGCAGAGTGGAAGGTGGGAGG - Intergenic
1089414484 11:118275835-118275857 CTGGGGGAGGCCAAGGTGGGAGG - Intergenic
1089445876 11:118551767-118551789 CAAGGTGAGTGGAAGGTAGCAGG - Exonic
1089560723 11:119341829-119341851 CTGGGTGGAGGGAAGGAGGGCGG - Intronic
1090138230 11:124223212-124223234 CAGAGCCAGTGGAAGGTGGGAGG - Intergenic
1090181492 11:124704128-124704150 CTGTGTGAGTGGAGGCTGGGTGG - Intergenic
1090203983 11:124874982-124875004 ATGGGAGAGTGGGAGGTGAGTGG + Intronic
1090909225 11:131104066-131104088 CTGTGTCTGTGCAAGGTGGGTGG - Intergenic
1202810788 11_KI270721v1_random:26444-26466 CTGTGTGGCTGGAAGGTGGAGGG - Intergenic
1091643086 12:2252451-2252473 CGTGCTGAGTGGAAGGTGGAAGG + Intronic
1091670047 12:2446315-2446337 ATGGGTGGTTGGATGGTGGGTGG + Intronic
1092231613 12:6778728-6778750 CACTGTGGGTGGAAGGTGGGTGG - Intergenic
1092427656 12:8387388-8387410 GTGGGGGCGTGGAGGGTGGGGGG - Intergenic
1092428922 12:8394369-8394391 GTGGGGGCGTGGAGGGTGGGGGG - Intergenic
1092697841 12:11193163-11193185 CTTGGAGGGTGGAGGGTGGGAGG + Intergenic
1093090611 12:14916015-14916037 CTTGGGGGGTGGAGGGTGGGAGG + Intronic
1093623483 12:21320159-21320181 CTGGAGGTGTGGAAGGTGGAAGG - Intronic
1094079701 12:26519997-26520019 CTGGCTGGGAGGTAGGTGGGAGG + Intronic
1094251041 12:28361865-28361887 CTGTGTGTGTGGGAGGGGGGCGG + Intronic
1094642184 12:32286990-32287012 ATGGGTGAGTGGAGGGCGAGGGG + Intronic
1095091175 12:38107802-38107824 CTGGGTGAATGACAGGTGAGAGG - Intergenic
1096116894 12:49060249-49060271 CGGGGGGAGCAGAAGGTGGGGGG - Intergenic
1096124593 12:49110217-49110239 CTGGGTGAGGGGTGGGAGGGAGG + Intronic
1096219689 12:49821260-49821282 CAGGCTGAGGGGAAGTTGGGGGG - Intronic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1096718437 12:53504589-53504611 CTAGGTGAGAGGAAGGAGAGAGG - Intronic
1097083808 12:56453053-56453075 CTGGGTGAGTGAAGGGAGAGGGG - Exonic
1097240962 12:57575003-57575025 ATGGGTAGGTAGAAGGTGGGAGG + Intronic
1098486757 12:71030422-71030444 CTGGGTGAGTGACACGTGGAAGG + Intergenic
1098731083 12:74037613-74037635 CTGGGGGAGAGAAGGGTGGGTGG - Intergenic
1099725897 12:86427497-86427519 CTGTGTGTGTGTAAGGTGGATGG - Intronic
1099921394 12:88961702-88961724 CTGGGTCAGTGGAAGGCAAGAGG + Intergenic
1100024161 12:90107365-90107387 CTGGGAAAGTAGAGGGTGGGAGG + Intergenic
1100314300 12:93430043-93430065 CTGGGTGAGTGAGTGGTGAGTGG - Intronic
1100551856 12:95653385-95653407 CTTGGTGAGGCCAAGGTGGGCGG - Intergenic
1100595069 12:96064547-96064569 CTGGGTGAGTAGTGAGTGGGTGG - Intergenic
1101082004 12:101196157-101196179 ATTGGAGGGTGGAAGGTGGGAGG - Intronic
1101351142 12:103930626-103930648 CTGGGGGCGTTGAACGTGGGAGG + Intronic
1101447009 12:104743760-104743782 TTTGGAGGGTGGAAGGTGGGAGG - Intronic
1101475277 12:105040402-105040424 GTGGGTGAGTGGCAGTGGGGAGG - Intronic
1101741753 12:107505680-107505702 ATTGGAGAGTGGACGGTGGGAGG - Intronic
1101801007 12:108021932-108021954 ATGAGTGAGTGGATGATGGGCGG - Intergenic
1102042380 12:109809097-109809119 ATGGGTGAATGGTGGGTGGGTGG - Intronic
1102567342 12:113805270-113805292 GTGGGTGGGGGGAAGGAGGGGGG + Intergenic
1102585692 12:113921385-113921407 GGGTGTGGGTGGAAGGTGGGGGG - Intronic
1102666669 12:114580072-114580094 CTGTGGGAGGCGAAGGTGGGGGG + Intergenic
1102756123 12:115342472-115342494 CGGGGTGGGGGGCAGGTGGGGGG - Intergenic
1102795417 12:115685061-115685083 ATGGGTGGGTGGATGGTGGGTGG + Intergenic
1102927736 12:116839498-116839520 GTGGGTGAGTGAACGGTAGGTGG + Intronic
1102988423 12:117297376-117297398 TTGGGTAAGTGGAAGGATGGTGG + Intronic
1103023466 12:117555100-117555122 CTGGGTGAGGGGTAGGAGGGAGG - Intronic
1103478030 12:121232818-121232840 CTTGGAGAAGGGAAGGTGGGAGG - Intronic
1103562487 12:121799957-121799979 CTGGAGGAGAGGAAGGTGGAGGG + Intronic
1103766505 12:123283967-123283989 CTGTGGGAGGGCAAGGTGGGTGG - Intergenic
1104147643 12:126050837-126050859 CTGGGTGAGTGAAGGGTGAGTGG - Intergenic
1104365531 12:128173212-128173234 GTGGGTGGTTGGAGGGTGGGAGG + Intergenic
1104583564 12:130029306-130029328 GCGGGTGAGTGGACGGTGGGTGG - Intergenic
1104630993 12:130401997-130402019 CTGGCTGAGTAGAATGTGGGTGG + Intronic
1104803192 12:131568693-131568715 ATGGGTGGGTGGATGGTGAGTGG - Intergenic
1104856455 12:131904569-131904591 CTGGGTGAGTGGCTGGGGGATGG + Intronic
1104913024 12:132249042-132249064 CTGGGTGTCTGGAAGGTGGCGGG + Intronic
1105538616 13:21293843-21293865 CTGGGAGAGTGGCAGGGGGTGGG - Intergenic
1106016963 13:25878795-25878817 CAGAGTGAGTGGAAGGTGCTGGG - Intronic
1107013172 13:35687653-35687675 GTGGGTGCGGGGGAGGTGGGTGG - Intergenic
1107628170 13:42312588-42312610 ATGGGTGAGGGGATGTTGGGGGG - Intronic
1107715277 13:43193586-43193608 CTGGTTGATTGGTAGGTGGATGG + Intergenic
1107769546 13:43775383-43775405 CTTGGTGAGACCAAGGTGGGAGG - Intronic
1108626049 13:52229780-52229802 CTGAGTTAGAGGAAGGTGTGTGG + Intergenic
1108660014 13:52576699-52576721 CTGAGTTAGAGGAAGGTGTGTGG - Intergenic
1108788048 13:53930912-53930934 GGGGGTGGGTGGCAGGTGGGTGG - Intergenic
1108800068 13:54084095-54084117 CTGTGTGACTGGCAGGTGGTCGG - Intergenic
1110162442 13:72395146-72395168 TTTGGAGAGTGGAGGGTGGGAGG - Intergenic
1113185519 13:107682358-107682380 CAGGATGAGTGCAAGGAGGGTGG - Intronic
1113406378 13:110044659-110044681 CTGGGAGAGGTGGAGGTGGGGGG - Intergenic
1113934158 13:113984613-113984635 ATGGGTGAGTGATAGGTGGATGG - Intronic
1113934835 13:113988523-113988545 ATGGGTGAGTGATAGGTGGATGG - Intronic
1113939738 13:114012366-114012388 CGGGGAGTGTGGAAGGTGTGTGG - Intronic
1113975662 13:114225605-114225627 CCGGGGGAGTGGAAGGGGAGGGG + Intergenic
1114615202 14:24064592-24064614 GTGGATGAGAGGGAGGTGGGGGG + Intronic
1114732493 14:25008258-25008280 CTGTGGGAGATGAAGGTGGGAGG + Intronic
1114873058 14:26681284-26681306 TTTGGAGAGTGGAGGGTGGGAGG - Intergenic
1114980421 14:28157649-28157671 CTGGATGAGGGGAACGTGGTGGG + Intergenic
1116185936 14:41600947-41600969 TTGGGAGGGTGGAAGGTGGGAGG + Intergenic
1117559158 14:56918137-56918159 GGAGGTGAGTGGAAGGTGAGTGG - Intergenic
1117596638 14:57332565-57332587 CTGTGTGTGTGCAAGGTGTGGGG + Intergenic
1118846416 14:69550830-69550852 CTGTGTGAGTGTGAGGTAGGTGG + Intergenic
1119415854 14:74468709-74468731 TTGGGTCAGTGGGAGGTGAGTGG - Intergenic
1119435920 14:74597778-74597800 GTGGTGGAGAGGAAGGTGGGAGG - Intronic
1119806635 14:77486465-77486487 GTGGATGAGTGGAAGGTGGAAGG + Intronic
1120015807 14:79471988-79472010 TTGGGAGGGTGGAGGGTGGGAGG - Intronic
1121097147 14:91225459-91225481 CTGGGTGACTGGCAGGCGGGTGG - Intronic
1121273290 14:92651883-92651905 CTGGGGGAGGGGGTGGTGGGCGG - Exonic
1121276217 14:92669633-92669655 CTGGGTGGGGGTGAGGTGGGGGG + Intronic
1121412351 14:93756772-93756794 CTGGGTGAATGGAGGATTGGGGG - Intronic
1121601590 14:95208898-95208920 CTGAGTGAGTGACAGATGGGTGG - Intronic
1121936705 14:98026308-98026330 ATGAGTGAGTGGATGGTGGGTGG + Intergenic
1121936716 14:98026379-98026401 GTGGATGAGTGGATGGTAGGTGG + Intergenic
1122077609 14:99246141-99246163 CTGGGTCCGAGGAAGGCGGGGGG - Intronic
1122185384 14:99988896-99988918 TTGGGTGGGTGGAGGGTGTGGGG + Intronic
1122272371 14:100573939-100573961 AAGGGTGGGTGGGAGGTGGGAGG + Intronic
1122329195 14:100901635-100901657 CAGAGTGAGTGGAAGGAGCGAGG - Intergenic
1122342888 14:101039836-101039858 CAGGGTAAGTGGAAAGTCGGTGG + Intergenic
1122600753 14:102920546-102920568 GTGGGTGAGTGAATGATGGGTGG - Intergenic
1122661146 14:103296185-103296207 CTGGGTGAGTCACAAGTGGGTGG + Intergenic
1122769813 14:104092958-104092980 CTGGGGGTGTGGGAGGAGGGTGG - Intronic
1122879839 14:104685805-104685827 GTGGATGAGTGGATGATGGGTGG + Intergenic
1122879849 14:104685836-104685858 ATGGGTAAGTGGATGGTGGGTGG + Intergenic
1122879870 14:104685917-104685939 GTGGGTGAGTGGCAAATGGGTGG + Intergenic
1122889176 14:104724658-104724680 AGGGGTGGGTGGAAGGAGGGCGG - Intronic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931268 14:104933869-104933891 CTGAGTGAGGGGAGGGCGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1123037578 14:105477766-105477788 GTGTGTGAGAGGAAGGTGTGTGG + Intronic
1123878926 15:24656205-24656227 ATGGGAGGGTGGAAGGTAGGAGG + Intergenic
1124636164 15:31366321-31366343 CTTGGTGAGAGGAAGGGGGCTGG - Intronic
1124883364 15:33662048-33662070 CAGGGTGGGTGGAAGGTTGGAGG - Intronic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125482897 15:40092784-40092806 CTGGGGGGGTGGAAACTGGGGGG + Intronic
1125575178 15:40750461-40750483 CTGGGGGAGGCCAAGGTGGGCGG - Intronic
1125580699 15:40783402-40783424 ATGGGTGAGAGGAAGGGAGGGGG + Intronic
1125611793 15:40976393-40976415 CTGGGGGGGTGGTAGGAGGGTGG + Intergenic
1125718774 15:41835220-41835242 CTGGGTGAGTGGAGGTGGGGTGG + Exonic
1125860841 15:42998469-42998491 GTGGGTGATTGGCATGTGGGTGG - Intronic
1125932342 15:43609451-43609473 CTGGGAGAGTGGGAGGCTGGTGG - Intronic
1125945438 15:43708923-43708945 CTGGGAGAGTGGGAGGCTGGTGG - Intergenic
1127292010 15:57579604-57579626 CTGGGTGAGGAGGATGTGGGTGG - Intergenic
1127420263 15:58798366-58798388 CTTTGAGAGTGTAAGGTGGGTGG - Intronic
1127719398 15:61684878-61684900 CTGGAAGAGTGGTAGGTGAGAGG - Intergenic
1127931860 15:63602033-63602055 CTGGGTGGGTGGAAGAGGCGAGG + Exonic
1127981526 15:64038569-64038591 CTGGCTGACTGGATGGTGGGTGG - Intronic
1128715967 15:69908255-69908277 ATGAGTGAGTGGGGGGTGGGTGG - Intergenic
1128797920 15:70478575-70478597 CAGGGCGAGTGGGAGGAGGGTGG - Intergenic
1129161810 15:73751949-73751971 CTGGCTGGGGGGAAGGTGGGGGG - Intronic
1129171409 15:73810387-73810409 CAGGGGGAGTGGCAGCTGGGAGG + Intergenic
1131176122 15:90210843-90210865 AGGAGTGAGTGGAAGGTGAGAGG + Intronic
1131670765 15:94617304-94617326 CTTGGAGAGAGGAAGGAGGGGGG - Intergenic
1132019090 15:98344920-98344942 GTGGATGGGTGGGAGGTGGGTGG + Intergenic
1132583822 16:697230-697252 CTGGGTGGTGGGAGGGTGGGTGG + Exonic
1132644795 16:993924-993946 GTGGGTGAGTGGATGGATGGGGG - Intergenic
1132644825 16:994027-994049 ATGGGTGAGTGGGTGGTGGATGG - Intergenic
1132644924 16:994357-994379 ATGGGTGAGTGGCTGGTGGTTGG - Intergenic
1132885768 16:2181310-2181332 CGGGGTGGGTGGCAGGTGGCTGG + Exonic
1132910225 16:2306484-2306506 CTGGGTCTGTGGAAGGAGGTGGG - Intronic
1133456144 16:5944015-5944037 CTGGATGAATGGATGGTGGATGG - Intergenic
1133467003 16:6036990-6037012 CTGTGTGTGTTGGAGGTGGGGGG + Intronic
1133676461 16:8077765-8077787 CTAGGTGAGTGGGAGTTGAGTGG - Intergenic
1133712862 16:8418217-8418239 CTACATGAGTGGAGGGTGGGAGG + Intergenic
1133734880 16:8607407-8607429 CTGGGGGAGTTGGATGTGGGAGG - Intergenic
1133753667 16:8745223-8745245 CTCTGGGAGTCGAAGGTGGGTGG - Intronic
1134106048 16:11486620-11486642 ATGGGTGGGTGGGTGGTGGGTGG + Intronic
1134112643 16:11524745-11524767 CTGGGTGGCTGGAGGGAGGGAGG - Intergenic
1134224423 16:12380445-12380467 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224428 16:12380460-12380482 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224468 16:12380582-12380604 ATGGGTGGATGGATGGTGGGTGG - Intronic
1134224488 16:12380643-12380665 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224519 16:12380743-12380765 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224596 16:12380993-12381015 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224603 16:12381012-12381034 GTGGGTGGGTGGATGGTGGGTGG - Intronic
1134224609 16:12381027-12381049 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224627 16:12381084-12381106 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224636 16:12381107-12381129 GTGGGTGGATGGATGGTGGGTGG - Intronic
1134224661 16:12381176-12381198 GTCGGTGGGTGGATGGTGGGTGG - Intronic
1134224670 16:12381199-12381221 GTGGGTGGGTGGATGGTAGGTGG - Intronic
1134224731 16:12381410-12381432 GTGGGTGGGTGGATGATGGGTGG - Intronic
1134224778 16:12381564-12381586 GTGGGTGGGTGGATGATGGGTGG - Intronic
1134224814 16:12381688-12381710 ATGGGTGGGTGGGTGGTGGGGGG - Intronic
1134234260 16:12453077-12453099 CTGGGAGAATGAAGGGTGGGAGG - Intronic
1134782415 16:16910184-16910206 GTGGGTGAGTGGATGGAGGGAGG + Intergenic
1134998826 16:18759803-18759825 GTGGGTGAGTGGAGAGTAGGTGG + Intergenic
1135113028 16:19705370-19705392 CTAGGTGAGTGGAAAGAAGGTGG + Exonic
1135113989 16:19710665-19710687 CTGGGGGAACGGAACGTGGGAGG + Intronic
1135351655 16:21734366-21734388 ATTGGAGAGTGAAAGGTGGGAGG + Intronic
1135629368 16:24023780-24023802 ATGGGTAAGTGGAAGGTTGGGGG - Intronic
1135726537 16:24858440-24858462 ATGAGTGAGTGGATGGTGGATGG + Intronic
1135976032 16:27109493-27109515 ATGGATGAGTGGTGGGTGGGTGG + Intergenic
1136223910 16:28846156-28846178 TTGGGGGAGTGGTAGGTGGCTGG - Intronic
1136295225 16:29297800-29297822 GTGGGTGGATGGATGGTGGGTGG + Intergenic
1136553231 16:30992795-30992817 CTGGGAGAGAGAAGGGTGGGGGG + Exonic
1136612869 16:31377838-31377860 CTGGGGGAGGCCAAGGTGGGAGG + Intronic
1136618988 16:31415516-31415538 CTGGGTGTGTGGATGGAGGTGGG - Intronic
1136702226 16:32154753-32154775 GTGGGCGGGTGGGAGGTGGGAGG - Intergenic
1136717950 16:32300211-32300233 CTTGGTGAGGTTAAGGTGGGTGG + Intergenic
1136836325 16:33506481-33506503 CTTGGTGAGGTTAAGGTGGGTGG + Intergenic
1136931099 16:34418552-34418574 CTTTGGGAGTTGAAGGTGGGAGG - Intergenic
1136973474 16:34993256-34993278 CTTTGGGAGTTGAAGGTGGGAGG + Intergenic
1137863228 16:51867889-51867911 CTGGGTGGGTGGGGTGTGGGGGG + Intergenic
1138544191 16:57706296-57706318 CTGGATCAGAGGATGGTGGGAGG - Intronic
1139349774 16:66327763-66327785 CTGGGTGGGTGGCAGGGGTGAGG - Intergenic
1139375745 16:66495371-66495393 CAGGGTGGGAGGGAGGTGGGAGG - Intronic
1139423836 16:66866554-66866576 CTCTGGGGGTGGAAGGTGGGGGG + Intronic
1139470826 16:67177337-67177359 CTGGGTGACTGTAAAGAGGGTGG - Intronic
1139573831 16:67829208-67829230 CTGGGTGAGGGGAAAGTATGTGG - Intronic
1139594239 16:67948823-67948845 TTGGGTGAGAGGAAGGGGTGTGG + Intronic
1139899934 16:70320349-70320371 CTGGGGGAGGCCAAGGTGGGAGG - Intronic
1139919352 16:70449545-70449567 CAGTGTGAGGAGAAGGTGGGTGG + Intergenic
1140581847 16:76240258-76240280 TTGGGAGGGTGGAGGGTGGGAGG + Intergenic
1140784242 16:78324776-78324798 CTGGGGGAGTTGGGGGTGGGCGG + Intronic
1141096803 16:81168596-81168618 ATGGATGGGTGGATGGTGGGTGG + Intergenic
1141131673 16:81441692-81441714 CTGGGATAGTGGAAGGTGGAGGG + Intergenic
1141178303 16:81734976-81734998 GTGGGTGAGAGAAGGGTGGGTGG + Intergenic
1141399197 16:83732408-83732430 CAGGGTGAGTTGATGGTGGGAGG + Intronic
1141483827 16:84325571-84325593 GTGGGTGGATGGATGGTGGGTGG - Intronic
1141601152 16:85127153-85127175 GTGGGTGGGTGGAAGGGGGTGGG - Intergenic
1141895610 16:86956979-86957001 ATGGATGGGAGGAAGGTGGGGGG + Intergenic
1142101126 16:88271811-88271833 GTGGGTGGATGGATGGTGGGTGG + Intergenic
1142124153 16:88401888-88401910 GTGGGTGAGTGGATGGATGGAGG + Intergenic
1142203904 16:88773681-88773703 CTGGGTGACAGGCAGGTCGGGGG + Intronic
1142203912 16:88773723-88773745 CTGGGTGACAGGCAGGTCGGCGG + Intronic
1142255670 16:89012602-89012624 ATGGGTGGATGGATGGTGGGTGG - Intergenic
1142353120 16:89588814-89588836 GGGGGTGAGGGGAAGGTGGTGGG - Intronic
1203008478 16_KI270728v1_random:217555-217577 CTTGGTGAGGTTAAGGTGGGTGG - Intergenic
1203067829 16_KI270728v1_random:1034954-1034976 GTGGGCGGGTGGGAGGTGGGAGG + Intergenic
1203146506 16_KI270728v1_random:1806774-1806796 CTTGGTGAGGTTAAGGTGGGTGG + Intergenic
1142502274 17:339777-339799 CTGGGTGTGTGGCAGGTGCTCGG - Intronic
1142610781 17:1108460-1108482 CTGGGTCAGCTGAAGGGGGGAGG - Intronic
1142761101 17:2042321-2042343 CTGGGTGGGAGGAATGCGGGTGG - Intronic
1142963001 17:3563062-3563084 CTGGGCCAGAGGGAGGTGGGAGG - Intergenic
1143002153 17:3801206-3801228 CTGGCTGAGGGGAAGCTGAGTGG - Exonic
1143027853 17:3951573-3951595 GTGGGCGTGTGGCAGGTGGGAGG - Exonic
1143102434 17:4511870-4511892 CTGGGGGTGTGGAAGGAGTGGGG - Intronic
1143116974 17:4586675-4586697 CGGGGTGGATGGAAGGTGGAGGG + Intronic
1143863072 17:9905215-9905237 CTGGGTGGGTGGGACGTGCGTGG + Exonic
1145095755 17:20024642-20024664 GTGGGAGATTGAAAGGTGGGAGG + Intronic
1145240197 17:21236461-21236483 ATAGGTGGGTGGATGGTGGGTGG - Intergenic
1145407274 17:22614754-22614776 CTGGGAGTGTGGAGGGTGGGAGG + Intergenic
1145792578 17:27637216-27637238 CTGAGAGAGATGAAGGTGGGGGG + Intronic
1146261665 17:31425995-31426017 CTGGGTCAGTGGAATGTGTCTGG + Intronic
1146283503 17:31559736-31559758 CTGGGGGAGGGGGAGGTGCGGGG - Intergenic
1146339871 17:32009368-32009390 TTGGGAGACTGGGAGGTGGGAGG - Intronic
1146911584 17:36651744-36651766 CTGGGGGAGAGGTAGGTAGGGGG - Intergenic
1147324521 17:39663886-39663908 ATGGGTGAGTGGAGTCTGGGAGG - Intergenic
1147503712 17:40992440-40992462 CTGGGTGATTAGAAGCTGAGTGG - Intergenic
1147583240 17:41638491-41638513 CTGGGAAGGTGGAGGGTGGGAGG - Intergenic
1148008794 17:44457688-44457710 CTGTGGGAGTCCAAGGTGGGAGG + Intronic
1148622467 17:49044725-49044747 CTGGGAGATTGGTAGGTGGAGGG + Intronic
1148889056 17:50794591-50794613 TCGGGCCAGTGGAAGGTGGGTGG + Intergenic
1149547042 17:57511388-57511410 CTGGGTAAGTGTGGGGTGGGTGG - Intronic
1149666393 17:58367691-58367713 CTGGGTGACTGGACAGAGGGTGG + Intronic
1149712942 17:58759069-58759091 GTGGGGGAGTGGAAGGTGGGCGG - Intronic
1150217293 17:63477681-63477703 CCGGGCGAGTGGAGGGTGGATGG - Intergenic
1150802751 17:68294644-68294666 CTGGGTGGGAGCATGGTGGGTGG - Intronic
1150806174 17:68320759-68320781 CTGGGTGGCTGGAAGGGCGGGGG + Intronic
1151031627 17:70746918-70746940 TTGGGAGGGTGGAGGGTGGGAGG + Intergenic
1151059879 17:71079708-71079730 TTCGGAGAGTGGAGGGTGGGAGG + Intergenic
1151378313 17:73707147-73707169 CTGGGGGAGGAGAAGGTTGGCGG - Intergenic
1151553852 17:74836841-74836863 CAGACTGGGTGGAAGGTGGGTGG - Exonic
1151554061 17:74837732-74837754 ATGGCTGAGTGGGAGGTGGCTGG - Exonic
1151720824 17:75855079-75855101 CGGGGTTGGAGGAAGGTGGGTGG - Intronic
1152103114 17:78314271-78314293 CAGGGTGAGCGGGAGGAGGGAGG + Intergenic
1152226045 17:79093269-79093291 CTGGGTGGTGGGAGGGTGGGAGG - Intronic
1152304797 17:79514214-79514236 CTGGCTGTGTGGACGCTGGGAGG - Intronic
1152312622 17:79560058-79560080 GTGGGTGGGTGGGTGGTGGGTGG + Intergenic
1152610879 17:81314547-81314569 CTGGGGGAGTTGCAGGTGGTGGG - Intronic
1152799286 17:82323481-82323503 CCGGGTGTGGTGAAGGTGGGAGG + Intronic
1152831111 17:82497460-82497482 CTGGGTGGGAGGGAGGTCGGCGG - Intergenic
1153120392 18:1717769-1717791 GCTGGTGAGTGGATGGTGGGGGG - Intergenic
1153416384 18:4850414-4850436 GGGGGTGAGAGGAAGGTGGCTGG - Intergenic
1153540225 18:6146080-6146102 CTGGGTGAGGGGAAGGGTGGCGG + Intronic
1154216671 18:12420793-12420815 CGGGGTGGGGGGACGGTGGGGGG + Intronic
1154304021 18:13217882-13217904 CTGGGAAAGTGGAAGCAGGGCGG + Intronic
1154377729 18:13823322-13823344 GTGGGTGGGTGGGTGGTGGGTGG - Intergenic
1155929313 18:31689320-31689342 CTATGGGGGTGGAAGGTGGGAGG + Intergenic
1156398919 18:36723379-36723401 GTGGGTGTGTGGATGGGGGGCGG + Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158702169 18:59758012-59758034 CTGGGTGAGGAGAAGGTTGGAGG - Intergenic
1158721826 18:59931960-59931982 CTGGGGGATTGGACTGTGGGGGG + Intergenic
1159386989 18:67739975-67739997 ATTGGAGGGTGGAAGGTGGGAGG - Intergenic
1159854943 18:73574991-73575013 CTGGGTGGGTTGGAGTTGGGTGG - Intergenic
1160018688 18:75163998-75164020 CTGGGAGAGTGGAGGCTGAGAGG + Intergenic
1160246878 18:77166246-77166268 CTCTGTGGGAGGAAGGTGGGAGG - Intergenic
1160253122 18:77221453-77221475 ATGGGTGGGTGGTGGGTGGGTGG - Intergenic
1160253148 18:77221588-77221610 TTGGGTGAGTGGTGGGTGGAAGG - Intergenic
1160318199 18:77867313-77867335 CAGGTGGAGAGGAAGGTGGGTGG - Intergenic
1160329425 18:77978142-77978164 CTGGGTGTGGGGAAGTAGGGAGG - Intergenic
1160526522 18:79541947-79541969 ATGGGTGGGTGGTGGGTGGGTGG - Intergenic
1160527114 18:79544510-79544532 CTCTGTGTGTGGAGGGTGGGCGG + Intergenic
1160687114 19:442266-442288 ATGGGTGAGTGGATGATGGATGG + Intronic
1160687607 19:443946-443968 ATGGGTGGGTGGATGGAGGGTGG + Intronic
1160692340 19:465817-465839 GTGGGTGGGTGGATGGTGGATGG + Intronic
1160960360 19:1718203-1718225 GTTGGTGGGTGGATGGTGGGTGG + Intergenic
1160960383 19:1718267-1718289 GTGGGTGGGTGGATGGTGGGTGG + Intergenic
1160960398 19:1718305-1718327 GTGGGTGGGTGGTGGGTGGGTGG + Intergenic
1160977774 19:1802250-1802272 GTGGATGAGTGGGGGGTGGGTGG - Intronic
1161090544 19:2357883-2357905 GTGGGTGGGTGGAAGGTGGGTGG - Intergenic
1161287682 19:3477318-3477340 GTGGGTGGATGGATGGTGGGTGG + Intronic
1161290357 19:3490780-3490802 TTGGGTGAGGGGAGCGTGGGAGG - Intergenic
1161347644 19:3776215-3776237 ATGTGTGAATGGATGGTGGGTGG + Intergenic
1161347731 19:3776547-3776569 ATGTGTGAGTGGATGGTAGGTGG + Intergenic
1161347763 19:3776669-3776691 GTGGATGAGTGGATGGTGGGTGG + Intergenic
1161347785 19:3776766-3776788 ATGGATGAGTGGATAGTGGGTGG + Intergenic
1161488056 19:4546366-4546388 CTGCGGGAGAGGGAGGTGGGTGG - Intronic
1161681420 19:5681551-5681573 ATGGATGAGTGGAAGGATGGGGG - Intronic
1161765476 19:6205521-6205543 CTGGGTGAGTGCAAGGTTCCTGG - Intergenic
1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG + Intronic
1161846343 19:6713736-6713758 CTGGGAGTGGGGAAGGTGGGGGG - Intronic
1161846389 19:6713831-6713853 CTGGGGGTGGGGAAGGTGGGGGG - Intronic
1161868948 19:6855739-6855761 AAGGGTGAGTGGATGGTGGTCGG - Intronic
1161984795 19:7647278-7647300 CTGGGTCTGTGTTAGGTGGGCGG + Intronic
1162067626 19:8135942-8135964 GTGGGTGAGTTGGGGGTGGGCGG - Exonic
1162085884 19:8248858-8248880 GTGGGTGGATGGATGGTGGGTGG + Intronic
1162141031 19:8585738-8585760 CTGGGTGATTGGAAGGGTGGGGG - Intronic
1162859573 19:13495961-13495983 ATGGGTGATTGGAGGGTAGGTGG - Intronic
1163456467 19:17409070-17409092 CTTGGTGAGTCCAAGTTGGGTGG - Intronic
1163609931 19:18295482-18295504 GTGGGTGAGTGGATGGTGGATGG - Intergenic
1163609980 19:18295650-18295672 ATGGATGAGTGGATGGTGGATGG - Intergenic
1163609990 19:18295695-18295717 ATGGATGAGTGGATGGTGGATGG - Intergenic
1163610009 19:18295776-18295798 GTGGATGAGTGGATGGTGGATGG - Intergenic
1163675486 19:18653605-18653627 GTGGGTGGGTGAAGGGTGGGTGG - Intronic
1163811219 19:19432996-19433018 CTGAGTGACTGGGTGGTGGGTGG + Intronic
1163817445 19:19475483-19475505 CTGGGGCAGTGGAGGGGGGGGGG - Intronic
1163820481 19:19493748-19493770 CTAGGTAGGTGTAAGGTGGGGGG - Intronic
1163983370 19:20922614-20922636 CTGGGTGCCTGGAATGTGGCTGG + Intergenic
1163993242 19:21018969-21018991 CTGAGTGACTGGAATGTGGCTGG + Intergenic
1164272779 19:23687853-23687875 CTGGGTGCCTGGAATGTGGCTGG - Intergenic
1164306022 19:24004194-24004216 ATGGATGAATGGGAGGTGGGAGG + Intergenic
1164579972 19:29428985-29429007 GTAGGAGAGGGGAAGGTGGGAGG + Intergenic
1164962643 19:32447962-32447984 CAGGAAGAGTGGGAGGTGGGTGG + Intronic
1165108307 19:33487216-33487238 CTGGGTGAGTGGAAGGCAGGGGG + Intronic
1165144421 19:33722231-33722253 ATGGGTGGATGGAAGGTGGGAGG + Intronic
1165320087 19:35079883-35079905 CTGTGTGAGTGCAAGGAGGCTGG + Intergenic
1165323869 19:35102793-35102815 GTGAGTGAGGGGCAGGTGGGAGG - Intergenic
1165465290 19:35971050-35971072 CTGGGAGAGTTGAATCTGGGAGG - Intergenic
1165710871 19:38009901-38009923 GTGGGTTGGAGGAAGGTGGGTGG + Intronic
1166315178 19:41985547-41985569 GTGGGTGAGTGGTGTGTGGGAGG + Intronic
1166390609 19:42407043-42407065 CTGGGTGAGCAGGAGCTGGGAGG + Intronic
1166646113 19:44533019-44533041 CTGGCTTAGGAGAAGGTGGGTGG - Intergenic
1166735081 19:45079276-45079298 CTCGGTGAGTACAAGGTGGTGGG + Exonic
1167103233 19:47416774-47416796 CTCGGTGTGTGGTGGGTGGGAGG + Intronic
1167610764 19:50506790-50506812 GTGGGTGGGTGGACGGTGGGTGG - Intronic
1167610838 19:50507093-50507115 GTGGGTGGGTGGGTGGTGGGTGG - Intronic
1167612216 19:50513012-50513034 CTGGGAGAGGGGAAAGAGGGCGG + Intronic
1167820322 19:51921916-51921938 CTCGGTGAGGGGGATGTGGGAGG - Intronic
1168274443 19:55269387-55269409 GAGGGTGGGTGGAAGGTGGGCGG - Intronic
1168325498 19:55536766-55536788 CTGGGTCGGAGGGAGGTGGGTGG - Intronic
925252528 2:2451986-2452008 GAGGGTGAGTGGAAGCAGGGTGG - Intergenic
925347806 2:3183040-3183062 CTGGGTGGGTGGATGGTGAGTGG - Intergenic
925347887 2:3183339-3183361 GTGGGTGAGTGGATAGTGGATGG - Intergenic
925457293 2:4027030-4027052 CTGGCTGAGTGGAAGCTGGAGGG + Intergenic
925585725 2:5462097-5462119 CAGGATGAGCTGAAGGTGGGAGG + Intergenic
926085389 2:10016580-10016602 CAGGGTGAGTAGGAGGAGGGAGG + Intergenic
926162170 2:10496694-10496716 GTGGGTGGGTGGCAGGTGGCAGG - Intergenic
927067362 2:19486821-19486843 TTGGGTGAGTGGTAACTGGGAGG - Intergenic
927506385 2:23617622-23617644 TTGGGAGTGTGGAGGGTGGGTGG + Intronic
927601177 2:24442901-24442923 CTTTGTGAGGGGAAGGTGGGAGG + Intergenic
927724272 2:25409088-25409110 CTGGAAAAGTGGCAGGTGGGAGG + Intronic
927734466 2:25506515-25506537 GTTGGAGAGTGGAGGGTGGGAGG - Intronic
928408203 2:31031581-31031603 CTTGGTGAGTTGGAGGTGAGAGG - Intronic
928427187 2:31189077-31189099 GTTTGTGAGTGGAAGGAGGGTGG + Intronic
929229087 2:39540693-39540715 TTGGGAGTGTAGAAGGTGGGGGG + Intergenic
929437665 2:41940701-41940723 CTGGGGCAGTGGGGGGTGGGGGG - Intronic
929667118 2:43841698-43841720 CTGGGTAAGAGGAAGGGGAGAGG - Intronic
930027554 2:47038631-47038653 GTGGGTGGGGGGAGGGTGGGTGG - Intronic
930049843 2:47206480-47206502 CTGGGCAAGAGGGAGGTGGGTGG + Intergenic
930400416 2:50877963-50877985 GTGGATGAGTGGCAGGTGGTTGG - Intronic
931166886 2:59757992-59758014 CTGGGGGGGTGGGCGGTGGGGGG + Intergenic
931372006 2:61672298-61672320 CTGGGTGAGGGAAGGGTGGATGG + Intergenic
931596098 2:63945386-63945408 ATTGGAGAGTGGAGGGTGGGAGG + Intronic
931763002 2:65432862-65432884 CTTGGTGTTTGGAAGGAGGGAGG - Intergenic
932343646 2:70982130-70982152 CTGGGGGAGGGGAAGGGGGTGGG - Intronic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
932752116 2:74377871-74377893 TTGGGAGAGTGGAAGGTAGTGGG - Intronic
932755649 2:74407436-74407458 ATTTGGGAGTGGAAGGTGGGAGG - Intergenic
933432164 2:82196916-82196938 CTGGGTCTGTGGAGGGTGAGTGG - Intergenic
933709583 2:85315573-85315595 CTGGGTGAGGGGGTGGAGGGAGG + Intergenic
933877017 2:86630129-86630151 CTAGCCCAGTGGAAGGTGGGAGG - Intronic
934111441 2:88747254-88747276 CTGGCTGTGTGGCAGCTGGGTGG - Intronic
934674844 2:96242254-96242276 ATGGATGAGAGGGAGGTGGGTGG - Intergenic
934768608 2:96894405-96894427 GTGGGTGAGTGGGTGGGGGGTGG - Intronic
935087125 2:99858745-99858767 TTTGGAGAGTGGAGGGTGGGAGG + Intronic
935589800 2:104835828-104835850 CAGGGTGTGGGGGAGGTGGGGGG + Intergenic
936267855 2:111023867-111023889 CTGCGATGGTGGAAGGTGGGTGG + Intronic
936667287 2:114610908-114610930 CTGGGTGCGTGGGAGAAGGGGGG - Intronic
937100217 2:119262955-119262977 CTGGCGGAGGGGAAGGAGGGTGG - Intronic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937446610 2:121963496-121963518 CTGGGTCAGTGGCTGGGGGGAGG + Intergenic
937474746 2:122205115-122205137 CTGGACGTGTGGAGGGTGGGTGG + Intergenic
937823686 2:126340946-126340968 GGGGGAGAGTGGAAGTTGGGGGG + Intergenic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
939817668 2:146916300-146916322 CTGAGTGAGTGGAAGTGAGGTGG + Intergenic
939933488 2:148259577-148259599 GTGGGTGAGTGGCAGGTAGCAGG + Intronic
939984238 2:148814317-148814339 CTGGGTGGGGTGGAGGTGGGAGG + Intergenic
940194639 2:151080195-151080217 CTGAGAGAGAGGACGGTGGGTGG + Intergenic
941095493 2:161236989-161237011 CTGGGTGGGCGGGAAGTGGGGGG - Intergenic
941185189 2:162313965-162313987 CTGTGTAAATGGAAGGTGTGTGG + Intronic
941238690 2:163010119-163010141 CTGGGAGAATGGAGGGTGGGTGG - Intergenic
941423367 2:165312144-165312166 CTGGATGAGTGGGAGGTGGCAGG - Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942224868 2:173806234-173806256 GTGGGTGTCTGGGAGGTGGGGGG - Intergenic
942601910 2:177650098-177650120 ATGGGGGAGTGGGAGGAGGGAGG - Intronic
942665101 2:178309108-178309130 CTGGTTGAGAGGAGGGTGGTGGG - Intronic
942809683 2:179983250-179983272 AAGGGAGAGTGGAGGGTGGGAGG - Intronic
944531314 2:200670308-200670330 CAGTGTGAGTGGAGGATGGGAGG - Intronic
945251599 2:207769595-207769617 CTGGGCGGGAGGAAGGCGGGAGG + Intergenic
945382902 2:209162763-209162785 GTTGGAGAGTGGAGGGTGGGAGG - Intergenic
945657884 2:212647500-212647522 AAGGGTAAGTGGAAGGTGAGTGG + Intergenic
946119083 2:217493411-217493433 GAGGGTGAATGGAGGGTGGGAGG - Intronic
946365708 2:219247754-219247776 CTGGGTGAGGAGCATGTGGGTGG + Exonic
946393932 2:219434112-219434134 TGGGGTGAGTGGAAGAAGGGAGG - Intergenic
947732185 2:232437400-232437422 CTGGGCGTGTGGAAGGGGAGGGG + Intergenic
948135966 2:235636558-235636580 CTAGGGGAGTGGACGCTGGGGGG - Intronic
948166670 2:235867866-235867888 CTGGGTGGGTGGTGGGTGGATGG - Intronic
948444690 2:238023171-238023193 CTGGGTCACTGGATGGTGGCAGG - Intronic
948695673 2:239732059-239732081 GTGGGAGGGTGGGAGGTGGGAGG - Intergenic
949034428 2:241810095-241810117 CTGGGGCAGGGGCAGGTGGGTGG - Intronic
949050627 2:241895659-241895681 CTGTGTGGGTGGATGGAGGGGGG + Intronic
949065739 2:241989524-241989546 ATGGATGAATGGATGGTGGGTGG - Intergenic
949065816 2:241989849-241989871 ATGGATGAATGGATGGTGGGTGG - Intergenic
1168741820 20:198616-198638 CTTGGAGGGTGGAGGGTGGGGGG + Intergenic
1168744448 20:226253-226275 ACTGGAGAGTGGAAGGTGGGAGG + Intergenic
1168928795 20:1604668-1604690 CTGGATGAGTGGAGGGTGGTGGG + Intronic
1168948216 20:1778730-1778752 CCAGGTGAGTCGCAGGTGGGCGG + Intergenic
1168969584 20:1921764-1921786 CTGGATGAGTGGAGGGTGGTGGG - Intronic
1169057762 20:2637565-2637587 CTTGGTGAGTTGGAGCTGGGTGG - Exonic
1169077460 20:2770037-2770059 CTGGGTAGGGGGTAGGTGGGAGG - Intergenic
1169091588 20:2864284-2864306 CTGGGTGAGGGCAAGGCTGGGGG + Exonic
1169159161 20:3361477-3361499 CAGGGAAAGTGGGAGGTGGGAGG + Intronic
1169510615 20:6260141-6260163 CTGGGTGAGTGAAGGATGTGAGG + Intergenic
1169557921 20:6768898-6768920 CGGGGTGGGTGGTGGGTGGGAGG + Intronic
1169910602 20:10644832-10644854 CTGGGAGAGTTCAAGGGGGGAGG + Intronic
1170500745 20:16973907-16973929 ATTGGAGAGTGGAGGGTGGGAGG - Intergenic
1171018666 20:21564302-21564324 CTGGATGGGTGGGAGGTGGCGGG + Intergenic
1171070794 20:22066529-22066551 GTGGGAGAGTGGAAGATTGGGGG + Intergenic
1171183440 20:23108017-23108039 ATGGGTGAGAGAAAGGTAGGTGG - Intergenic
1171274915 20:23848236-23848258 GTGGGTGAGAGGAGGGTGTGGGG + Intergenic
1172047231 20:32089061-32089083 CTGGGTGATTGGGTGGTGAGGGG - Intronic
1172231689 20:33340963-33340985 CAGGGTGATTGGAAGGTGGAGGG - Intergenic
1172240827 20:33411483-33411505 CTGGGGGAGGTGGAGGTGGGTGG - Intronic
1172254848 20:33508572-33508594 ATGGGAAAGTGGAGGGTGGGAGG - Intronic
1172275555 20:33677082-33677104 GTGGGTGATGGGTAGGTGGGTGG - Intronic
1172298233 20:33829188-33829210 CTGGGAGAGAGGAGGGTGTGTGG + Intronic
1172354263 20:34268845-34268867 CTGGGGGAGCGGGCGGTGGGCGG + Intronic
1172479924 20:35265096-35265118 TGGGGTGAGAGGAAGGAGGGAGG + Intronic
1172666949 20:36606666-36606688 CTGGGTGAGTGTGAGGTGTGGGG + Intronic
1172862190 20:38063246-38063268 GTGGGGCACTGGAAGGTGGGGGG - Intronic
1173043999 20:39492079-39492101 CTGGGGGAGTTGGGGGTGGGGGG + Intergenic
1173502974 20:43566885-43566907 GTGGGTGGGTAGAAGGAGGGAGG + Intronic
1173729613 20:45319135-45319157 CTGGGTGACTGGGTGGTGTGGGG - Intergenic
1174098690 20:48109976-48109998 AGGGGTGGGTGGATGGTGGGTGG - Intergenic
1174157809 20:48528106-48528128 CTGGGTGAACGGAAGCTGGCGGG + Intergenic
1174396225 20:50248345-50248367 CTGGGTGAGGGGCAGATGGGTGG - Intergenic
1174449095 20:50608981-50609003 CAGGGAGAGTGGAAGGCGGAGGG - Intronic
1174750179 20:53104246-53104268 GGGGGTGGGGGGAAGGTGGGAGG + Intronic
1174774733 20:53333396-53333418 CTGGTTGAATGGGAGTTGGGAGG + Intronic
1174855027 20:54036048-54036070 ATTGGAGGGTGGAAGGTGGGAGG + Intronic
1175098064 20:56557834-56557856 CTTTGGGAGTGGGAGGTGGGTGG + Intergenic
1175313961 20:58032936-58032958 CGGGGTGGGTGGAGGGTTGGGGG + Intergenic
1175676476 20:60950397-60950419 ATGGGTAAGTGGATGATGGGTGG + Intergenic
1175691897 20:61071521-61071543 CTGAGTAAGTGGAGGGTGAGAGG + Intergenic
1175817265 20:61889780-61889802 ATGGGTGAGTGGATGGTGGATGG + Intronic
1175817331 20:61890124-61890146 ATGGGTGAGTGGATGGTGGATGG + Intronic
1175854260 20:62111918-62111940 CTGGGGGAGGTGAGGGTGGGAGG + Intergenic
1176017983 20:62946680-62946702 CTGGGAGAGTGGTAGTTGGAAGG - Exonic
1176057911 20:63158475-63158497 ATGGGTGAATAGATGGTGGGTGG + Intergenic
1176057958 20:63158651-63158673 GTGGATGAGTGGATGGTGGATGG + Intergenic
1176234769 20:64049140-64049162 CTGGGTGAGCGGCGGGAGGGCGG - Exonic
1176283522 20:64328524-64328546 CTGGAGGAGAGGAAGGTGTGGGG + Intergenic
1177118491 21:17113387-17113409 TTCGGAGAATGGAAGGTGGGAGG + Intergenic
1178264575 21:31131075-31131097 ATGAATGAATGGAAGGTGGGTGG - Intronic
1179035814 21:37758020-37758042 CTGGGTGGGTTGAGGGTGTGGGG + Intronic
1179044187 21:37830256-37830278 TTAGGCAAGTGGAAGGTGGGAGG + Intronic
1179126657 21:38596895-38596917 GTGACTGAGTTGAAGGTGGGTGG - Intronic
1179411543 21:41167383-41167405 CTGGGAGGGTGGAGGGTGGAAGG - Intergenic
1179939583 21:44628933-44628955 CTGGGTGGGTGGAGGGCCGGTGG + Intronic
1179986858 21:44927081-44927103 CTGGGCGAAGGGAAGCTGGGGGG - Intronic
1180085974 21:45508084-45508106 GTGGGTGAGTGGATGGATGGTGG + Intronic
1180161166 21:45999300-45999322 CTGGGAGAGTGGGAGGCGGCGGG + Intronic
1180190649 21:46161003-46161025 CCGGGGGAGGGGAAGGGGGGAGG + Intergenic
1181185899 22:21103407-21103429 CTGGGTGGGGGGGAGGGGGGAGG + Intergenic
1181471791 22:23145245-23145267 CTGGATGGGTGGGCGGTGGGCGG - Intergenic
1181728709 22:24829377-24829399 ATGGAAGGGTGGAAGGTGGGAGG + Intronic
1181875240 22:25935509-25935531 TTGGGTGAGGGGGAGGTGAGAGG + Intronic
1181979035 22:26752963-26752985 CTGGAGGAGTGAAGGGTGGGGGG + Intergenic
1182096848 22:27631170-27631192 CTGGGGTGGTGGGAGGTGGGTGG - Intergenic
1182437110 22:30337767-30337789 CTGGGCGCGTGGATGATGGGCGG + Exonic
1182772190 22:32803630-32803652 AAGGGTAAGTGGAATGTGGGTGG - Intronic
1182892670 22:33832013-33832035 CTGGGTGAAAGGAAGAAGGGAGG - Intronic
1183083960 22:35475129-35475151 CAAGGTCAGTGGGAGGTGGGTGG + Intergenic
1183098509 22:35569026-35569048 CTGCATGCGGGGAAGGTGGGAGG + Intergenic
1183279504 22:36924400-36924422 CTGGGAGAGGGCATGGTGGGTGG - Intronic
1183507883 22:38219646-38219668 CTGTTTGCGTGGAGGGTGGGGGG - Exonic
1183668716 22:39259609-39259631 CAGGGTGGGTGGGAGGTGCGTGG + Intergenic
1184110005 22:42389012-42389034 CTGGGTGGGTGGAGGGTTGGGGG - Intronic
1184123708 22:42471705-42471727 ATGGGTGGGTGGATGGTGGATGG - Intergenic
1184150643 22:42636363-42636385 CTGGGGGAGGGGGAGGAGGGAGG + Intronic
1184284821 22:43464613-43464635 CTGGATGGGTGCAAGGTGGGAGG + Intronic
1184414729 22:44345635-44345657 ATGGGTGAGTAGATGATGGGCGG + Intergenic
1184523297 22:45008074-45008096 CTAGGGAAGTGGAAGGTGGTGGG + Intronic
1184729726 22:46365854-46365876 TTGGGTGGGGGGAAGGTGGTGGG + Intronic
1184729766 22:46365945-46365967 CTGGGTGGGGGAAAGGTGGTGGG + Intronic
1184744623 22:46449129-46449151 CTGGGTGAGTGGATGGAAGCTGG - Intronic
1184765826 22:46571965-46571987 CTGGGTGATAAGCAGGTGGGAGG - Intergenic
1185074906 22:48677933-48677955 CTGGGGGACTGGAAGGTCTGGGG - Intronic
1185079373 22:48701309-48701331 CGTGGTGAGAGGAAGCTGGGTGG + Intronic
1185108619 22:48888193-48888215 GTGGGTGAGTGGATGGATGGAGG - Intergenic
1185149046 22:49153917-49153939 CAGGGTGTGGGTAAGGTGGGAGG + Intergenic
1203247492 22_KI270733v1_random:85027-85049 CTGGGGGGGAGGGAGGTGGGCGG - Intergenic
949268826 3:2190612-2190634 CTGCATGGGTGGTAGGTGGGAGG + Intronic
949712321 3:6885577-6885599 CTGGGTGTGTGGTAGGAGGCAGG - Intronic
949905490 3:8855144-8855166 ATGTGTGAGTGGAAGAAGGGAGG - Intronic
950202938 3:11057607-11057629 ATGGGTGAGTGGATGGTGAATGG + Intergenic
950230242 3:11269921-11269943 CTTTGTGAGGTGAAGGTGGGAGG + Intergenic
950366400 3:12488149-12488171 CTGAGGGAGGGGAAGGTGAGTGG - Intronic
950551467 3:13668767-13668789 CAGGGGGAGTGGAAGAGGGGAGG - Intergenic
950581865 3:13867623-13867645 CAGGGTGAGTGGGCTGTGGGAGG - Intronic
950785109 3:15427755-15427777 CTGGGTGCGAGGCAGGTGCGGGG + Exonic
951274312 3:20666461-20666483 CAGGGTGAGTAGAAGGTGAGAGG + Intergenic
951754712 3:26077430-26077452 ATGGGAGAATGGAGGGTGGGGGG - Intergenic
952088268 3:29853152-29853174 CTCAGAGAGTGGAGGGTGGGAGG + Intronic
952123531 3:30273390-30273412 CTGGGAGGGTTGAGGGTGGGGGG - Intergenic
952643027 3:35620942-35620964 TTTGGAGAGTGGAGGGTGGGAGG + Intergenic
952867077 3:37861682-37861704 CAGGGTGAGTGGAGGGCGGGAGG - Intergenic
953069125 3:39502411-39502433 CAGGGAGACTGGAAGGTGGGTGG + Intronic
953149737 3:40314014-40314036 CTGTGTGAGTCCAAAGTGGGTGG + Intergenic
953805761 3:46066029-46066051 AAGGGTGGGTGGAAGGAGGGAGG + Intergenic
953986513 3:47447444-47447466 CTTGGTGAGGCAAAGGTGGGCGG + Intronic
954061863 3:48074609-48074631 CAGGGTGAGGATAAGGTGGGAGG - Intronic
954628783 3:52037121-52037143 CTGGGCTGGGGGAAGGTGGGAGG + Intergenic
954925625 3:54231843-54231865 CATGGTGAATGGAAGGGGGGTGG + Intronic
955047470 3:55373622-55373644 GTTTGTGGGTGGAAGGTGGGAGG + Intergenic
955140287 3:56261858-56261880 ATTGGAGGGTGGAAGGTGGGAGG - Intronic
955422990 3:58758679-58758701 GTGGGTGAGGGGAAGGGGGAGGG - Intronic
956126410 3:66015026-66015048 CTGGGTGAGGGGATGGTGGTGGG - Intronic
956718327 3:72097892-72097914 CTGGGAGAGAGAAAGGTTGGAGG + Intergenic
957384115 3:79472943-79472965 CTAGGTGAGGGGAAGGTGCTAGG + Intronic
957831975 3:85532997-85533019 CTTGGAGGGTGGGAGGTGGGAGG + Intronic
958703343 3:97621261-97621283 CTCAGAGAGTGGAGGGTGGGAGG + Intronic
958734089 3:97989343-97989365 GTGGGTGAGTGGGTGGTGTGTGG + Intronic
959068448 3:101680605-101680627 CTGGGAGTGTGGAAGGTGGAAGG - Intergenic
960338356 3:116445594-116445616 CAGGGTGGGGGGAGGGTGGGGGG - Intronic
960788500 3:121400214-121400236 CTGGGTGAGAGGTAGGTGGGAGG - Intronic
960989468 3:123301339-123301361 CTGGGTGATTGGATTGTGGGGGG + Intronic
961358908 3:126355720-126355742 ATGAGTGAATGGAAGGTGCGGGG + Intronic
962249149 3:133824399-133824421 ATGGGTGAGGGGAAAGTGAGGGG + Exonic
962317577 3:134368374-134368396 CTGGGTGAGTGGGGGGTGGGGGG - Intronic
962368003 3:134798324-134798346 CTGCCTGGGTGGAAGGAGGGAGG + Intronic
962608455 3:137052074-137052096 ATTGGAGAGTGGAGGGTGGGAGG + Intergenic
962754115 3:138455390-138455412 CTGGGTGGGAGAAAGGTGGGAGG - Intronic
962771771 3:138618087-138618109 CTGGGGGAGGCTAAGGTGGGAGG - Intronic
963081670 3:141400926-141400948 CCCTGTGACTGGAAGGTGGGAGG - Intronic
966202020 3:177367469-177367491 GTGGGTGAGAAGAAAGTGGGTGG + Intergenic
966351576 3:179037382-179037404 CTAGATGAGGGGAATGTGGGTGG - Intronic
966362160 3:179141860-179141882 ATGGGAGGGTGGAGGGTGGGAGG + Intergenic
967650398 3:191978382-191978404 ATTGGAGAGTGGAAGGTGGGAGG + Intergenic
968429581 4:548678-548700 TTGGGAGACTGGGAGGTGGGAGG - Intergenic
968434505 4:577435-577457 GTGGGTGAGAGGAAGGCGTGGGG + Intergenic
968562536 4:1292121-1292143 CCGGGGTTGTGGAAGGTGGGGGG + Intronic
968870422 4:3239235-3239257 CTGGGTGAGGGGAGCGAGGGTGG + Intronic
968978517 4:3834427-3834449 CTGTGTGGGTGGATGGAGGGTGG - Intergenic
969158714 4:5236244-5236266 CTGAGTGAGTGCCAGGTGGAAGG - Intronic
969442644 4:7226486-7226508 CCGGGTGAGTGGGGGTTGGGGGG + Intronic
969501625 4:7556873-7556895 GTGGGTGGGTGGATGGTGGATGG - Intronic
969575613 4:8034490-8034512 GTGGGTGGGTGGTAGGTAGGTGG + Intronic
969575623 4:8034519-8034541 GTGGGTGGGTGGTAGGTAGGTGG + Intronic
969575653 4:8034605-8034627 GTGGGTGGGTGGTAGGTAGGTGG + Intronic
969870845 4:10103790-10103812 TTGGGAGAGTGGGAGGAGGGAGG - Intronic
970369196 4:15390920-15390942 TTGGGAGAGTGGGAGGTGGCAGG - Intronic
970415937 4:15856901-15856923 CTGGGGTTGTGGAAGGTGTGTGG + Intergenic
973955520 4:56059502-56059524 CTGGCTGGGTGGAATGTGGATGG - Intergenic
973959683 4:56097282-56097304 CTGGGAGAGTGGAAGATGAATGG + Intergenic
973995341 4:56452923-56452945 TTGGGGGAGTGGGAGGTTGGGGG + Intronic
974516338 4:62917838-62917860 CTGGGTGAGTGATAAGTGAGTGG + Intergenic
974639751 4:64612821-64612843 CTGGGTAACTGAAAGTTGGGAGG + Intergenic
974875744 4:67701041-67701063 CTGGGGGACTGGCAGGTGAGAGG - Exonic
974955548 4:68636602-68636624 CTTGGAGGGTAGAAGGTGGGAGG + Intronic
974971481 4:68834893-68834915 TTTGGTGTGTGGAAGGGGGGTGG - Intergenic
975401578 4:73944541-73944563 CGGGGTGGGTGGGTGGTGGGCGG + Intergenic
975621653 4:76302748-76302770 GGGGGTTGGTGGAAGGTGGGGGG + Intronic
975989931 4:80248248-80248270 ATTGGAGAGTGGAGGGTGGGAGG + Intergenic
976149738 4:82079948-82079970 GGGGTTGGGTGGAAGGTGGGAGG - Intergenic
976264809 4:83180528-83180550 CAGGGTAAGGGGAAGTTGGGGGG - Intergenic
976393579 4:84531767-84531789 CTAGGTGAGTGGCAGGAGAGGGG + Intergenic
976470568 4:85423978-85424000 CTGTGTGTGTGGAAGGGGGGCGG + Intergenic
979008088 4:115330203-115330225 ATCAGAGAGTGGAAGGTGGGAGG - Intergenic
979496200 4:121385722-121385744 CTGGGTGAGTGAGATGTGAGTGG - Intergenic
979522092 4:121679341-121679363 CTAGGTGAGTGAGAGGTGTGAGG - Intronic
979528788 4:121745815-121745837 GTGGGTCAGGGGAAGGGGGGAGG - Intergenic
980175569 4:129340261-129340283 TTCAGAGAGTGGAAGGTGGGAGG - Intergenic
980343750 4:131584581-131584603 GTGGGTGAGTGGCAGGTAGCTGG + Intergenic
980985693 4:139692300-139692322 CTGGGTGAGCAGCAGGTGGCTGG - Intronic
981531725 4:145760831-145760853 TTGGGTGAGGGGATGCTGGGAGG + Exonic
981850533 4:149224458-149224480 ATTGGAGAGTGGAGGGTGGGAGG + Intergenic
981937049 4:150249681-150249703 CATGGTGAGTGGAAGGCGGCAGG + Exonic
982961948 4:161850503-161850525 CTGGGTGAGGGCAAAGAGGGTGG + Intronic
983419441 4:167499487-167499509 ATTGGGGAGTGGATGGTGGGAGG - Intergenic
983887458 4:172996384-172996406 ATGGGAGGGTGGAGGGTGGGAGG + Intronic
983899541 4:173119180-173119202 ATTGGAGAGTGGAGGGTGGGAGG + Intergenic
983996425 4:174188223-174188245 CTTGGAGAGTGGAGGGTGGGAGG + Intergenic
984296718 4:177862561-177862583 CGTGGTGAGCGGAGGGTGGGGGG - Intronic
984589120 4:181596928-181596950 TTGGGAGGGTGGAGGGTGGGAGG + Intergenic
984736668 4:183115020-183115042 ATTTGAGAGTGGAAGGTGGGAGG - Intronic
985132033 4:186748441-186748463 TTTAGTGAGTGGAGGGTGGGAGG - Intergenic
985361216 4:189177958-189177980 CAGTGTGAGTGGAATGTGTGGGG - Intergenic
985668805 5:1195966-1195988 CTGCGTGCCTGGGAGGTGGGAGG - Intergenic
985668848 5:1196146-1196168 CTGCGTGCCTGGGAGGTGGGAGG - Intergenic
985705596 5:1399877-1399899 CTGCGTGCCTGGGAGGTGGGTGG - Intronic
985808871 5:2068672-2068694 GTGAGTCAGTGGAGGGTGGGAGG + Intergenic
985838910 5:2291120-2291142 CTGGGTGATTGGGAGCTGGGCGG - Intergenic
986602069 5:9482460-9482482 CTGGGTGAGTGGAAGGTGGGAGG + Intronic
987132958 5:14875711-14875733 CTTGGTGAGGGGTCGGTGGGGGG - Intergenic
987173316 5:15281467-15281489 ATTGGTGAGTGGGGGGTGGGAGG + Intergenic
987804499 5:22745758-22745780 TTTGGAGAGTGGAGGGTGGGAGG + Intronic
987895010 5:23933293-23933315 TTCGGAGAGTGGAGGGTGGGAGG + Intergenic
988147302 5:27327004-27327026 TTTGGAGGGTGGAAGGTGGGAGG + Intergenic
988736829 5:34030928-34030950 ATGGGAGGATGGAAGGTGGGAGG + Intronic
988871073 5:35390572-35390594 ATGGGAAAGTGGAGGGTGGGAGG + Intergenic
989085614 5:37673047-37673069 ATGGGAGGGTGGAGGGTGGGAGG - Intronic
989206967 5:38819162-38819184 ATGGGAGGATGGAAGGTGGGAGG + Intergenic
989213759 5:38882640-38882662 CGGGGTGGGGGGAAGGGGGGTGG + Intronic
990325767 5:54673921-54673943 CTGTGTGTGTAGTAGGTGGGTGG - Intergenic
990449100 5:55918794-55918816 CTGGGTGGGTGGTGGGGGGGTGG - Intronic
990468960 5:56095734-56095756 CTGTGAGATTGGAAGGTGGGAGG - Intergenic
990493173 5:56321608-56321630 GGGGGTAAGTGGCAGGTGGGAGG - Intergenic
991513154 5:67402757-67402779 CTGGTTGAGAGAAACGTGGGAGG + Intergenic
991601368 5:68354564-68354586 CTGGATGAGAGGAAGGAGGTAGG - Intergenic
991947624 5:71915010-71915032 GTGGGTGGGCGGAAGGTGGGGGG + Intergenic
992371027 5:76144390-76144412 CTGGGTTTGTGGAAGGGGTGGGG + Intronic
992481765 5:77158609-77158631 CTGGGTGGGTGGCCTGTGGGTGG + Intergenic
993044630 5:82853474-82853496 ATGGGTGATTGGAAGGAGGCAGG - Intergenic
994119689 5:96100101-96100123 CTGGGCTAGTGGAATGTGTGAGG + Intergenic
994160284 5:96549563-96549585 GTGGGCGAGTGGAAGCAGGGCGG + Intronic
994262263 5:97673815-97673837 ATTGGAGAGTGGAGGGTGGGAGG - Intergenic
994340080 5:98616970-98616992 GTGGGGGGGTGGGAGGTGGGGGG - Intergenic
994788176 5:104189430-104189452 GTGGGTGAGTGGCAGGTAGCTGG - Intergenic
995122373 5:108549829-108549851 GGGAGTGAGTGGAAGGTGGTGGG + Intergenic
995482442 5:112606616-112606638 CTTGGAGAGTCCAAGGTGGGTGG + Intergenic
995555001 5:113318676-113318698 ATGGGAGGGTGGAGGGTGGGAGG + Intronic
995906489 5:117130371-117130393 CTTGGCAGGTGGAAGGTGGGAGG - Intergenic
996385414 5:122905242-122905264 GTGGGAGATTGGGAGGTGGGAGG + Intronic
996552152 5:124742355-124742377 CTGGCTGCTTGGAATGTGGGAGG - Intronic
996605585 5:125317655-125317677 CTTGGAGAGTGGAGGGAGGGAGG - Intergenic
997038410 5:130221542-130221564 GTTGGAGGGTGGAAGGTGGGAGG - Intergenic
997085880 5:130797957-130797979 ATGGGTTAGTGGAAGGTTTGTGG - Intergenic
997305476 5:132832684-132832706 AGAGGTGAGTGGTAGGTGGGTGG - Intergenic
997305490 5:132832778-132832800 AGAGGTGAGTGGTAGGTGGGTGG - Intergenic
997309291 5:132866502-132866524 CTGGGTGACCCGTAGGTGGGAGG - Intronic
997647890 5:135493074-135493096 ATGGGTGAATGGATGGTGGCTGG + Intergenic
997665570 5:135627250-135627272 ATGGGAGACTGGAGGGTGGGAGG + Intergenic
997823268 5:137084788-137084810 CTGGGTCAGTGGCAGCTGAGAGG - Intronic
998567781 5:143231472-143231494 GTGCCTGAGTGGAGGGTGGGAGG - Intergenic
998601387 5:143588807-143588829 ATTGGAGAGTGGAGGGTGGGAGG + Intergenic
998764188 5:145466878-145466900 CAGGGTGGGTGGTAGGTGTGAGG - Intergenic
999110859 5:149120368-149120390 ATTGGAGGGTGGAAGGTGGGAGG + Intergenic
999232587 5:150070340-150070362 CTGGGAGATTGGGAGGTGGCGGG - Intronic
999314298 5:150574265-150574287 CTGGGAGAGTGGCAGGGAGGAGG + Intergenic
1000332852 5:160219526-160219548 ATGGGTGGATGGAAGGTGGAGGG + Intronic
1001016131 5:168142915-168142937 CTTGGGCAGTGAAAGGTGGGTGG - Intronic
1001049138 5:168400327-168400349 CTGGGAGGGTGGAGGGTGAGAGG - Intronic
1001089026 5:168723337-168723359 GTGGGTGGATGGATGGTGGGAGG - Intronic
1001492850 5:172168012-172168034 CTGGCTGAGTGGCAGGTGTGAGG + Intronic
1001514502 5:172346026-172346048 CTGGGTGGGTGGAGGTGGGGCGG - Intronic
1001663463 5:173413474-173413496 CTGGGTGAGGGGATGGTGGGGGG + Intergenic
1001686386 5:173597680-173597702 GTGGGTGAGTGGATGGAGGGAGG - Intergenic
1001686461 5:173597880-173597902 GTGGGTGAGTGGATGGAGGGAGG - Intergenic
1001686493 5:173597964-173597986 GTGGGTGAGTGGATGGAGGGAGG - Intergenic
1001842348 5:174889129-174889151 CTCGGAGAGCGGAGGGTGGGAGG - Intergenic
1001900207 5:175420705-175420727 GTGGGTGAATGGAAGGATGGAGG - Intergenic
1001925883 5:175636826-175636848 TTGGAAGGGTGGAAGGTGGGAGG + Intergenic
1002060311 5:176621729-176621751 AGGGATGAGTGGAAGGTGGCGGG - Intronic
1002169183 5:177366009-177366031 CTGGCTGAGTGGGAGGGAGGAGG + Intronic
1002210468 5:177595883-177595905 GTGTGTGAGTTGAGGGTGGGTGG + Exonic
1002298634 5:178245497-178245519 ATGGGTGGGTGGATGATGGGTGG - Intronic
1002298639 5:178245512-178245534 ATGGATGAGTGGATGATGGGTGG - Intronic
1002461526 5:179376080-179376102 CTGGGGGAGGGGAAAGGGGGAGG + Intergenic
1002467063 5:179412934-179412956 GGGGGAGAGTGGAAGGTCGGGGG - Intergenic
1002506387 5:179682005-179682027 CTTTGGGAGGGGAAGGTGGGTGG + Intronic
1002673456 5:180889543-180889565 GAGGGTGAGTGGAAGCAGGGTGG + Intergenic
1002898978 6:1394964-1394986 CTGGCTAAGTGGCAGGTGTGTGG - Exonic
1003672773 6:8174787-8174809 CTGTGGGAGTGAAAGGTGGTGGG + Intergenic
1004275380 6:14231071-14231093 CTTGGTGAGTGGAAAGTGCAGGG + Intergenic
1005063458 6:21797247-21797269 CCGGGAGAGAGGGAGGTGGGGGG - Intergenic
1005882797 6:30073728-30073750 CTTGGGGAGTGGAAAGGGGGAGG - Intronic
1006023621 6:31133003-31133025 CTGGGGGAGTGGGAGGGTGGTGG + Intronic
1006062944 6:31439168-31439190 CTGAGTGAGTGGGCAGTGGGTGG + Intergenic
1006122018 6:31813064-31813086 CTTGGTGACTTGGAGGTGGGAGG - Intronic
1006272549 6:32975138-32975160 CAGAGTGGGTGGGAGGTGGGTGG + Intronic
1006384195 6:33720122-33720144 ATGGGTGAGGGGAGGGCGGGTGG - Intergenic
1006430584 6:33993324-33993346 CTGAGTGAGTGGGAAGTGGAAGG + Intergenic
1006450071 6:34100495-34100517 CTGGGAGAGTGTATGGGGGGAGG - Intronic
1006734397 6:36262270-36262292 GTGGGAGAGTGGAGGATGGGAGG - Intronic
1006782940 6:36644333-36644355 CTGAGTGAGTGGAGTTTGGGAGG - Intergenic
1007291571 6:40791200-40791222 CTGGGTGTGAGGAAGATAGGAGG - Intergenic
1007371084 6:41427542-41427564 CTGGGAGAGGGGAAGCTGGGGGG + Intergenic
1007481429 6:42152889-42152911 CTGTGTGTGTGCAAGGTGTGGGG + Intergenic
1007486090 6:42181724-42181746 CTGGGTGTGGGGGAGGTGTGGGG + Intergenic
1007741274 6:44011036-44011058 GTGCGTGCGTGGAAGCTGGGAGG - Intergenic
1008768730 6:54952365-54952387 TTGGGGGAGTGGGAGGTGGTGGG - Intergenic
1008823119 6:55657902-55657924 TTTGGAGAGTGGAAGGTGGAAGG + Intergenic
1009338828 6:62528217-62528239 TTTGGAGAGTGGAGGGTGGGAGG + Intergenic
1009382614 6:63051787-63051809 ATGGGAGGGTGGAAGGTGGGAGG - Intergenic
1009508395 6:64516292-64516314 TTTGGAGAGTGGAAGGTGGAAGG + Intronic
1009702629 6:67202707-67202729 TTGGGGGTGTGGAAGGTGGGTGG + Intergenic
1009712696 6:67346324-67346346 GTGGGTGAGTGGCAGGTAGGTGG - Intergenic
1010363179 6:75018304-75018326 GTGGGGGAGTGGGAGGGGGGAGG + Intergenic
1010395173 6:75383552-75383574 CTTGGTGAGTGGAATGTGGGAGG - Intronic
1010717231 6:79243701-79243723 ATGTGTGAGTGGGAGGTGGGAGG + Intergenic
1010923360 6:81712362-81712384 ATCTGAGAGTGGAAGGTGGGAGG + Intronic
1011281085 6:85678686-85678708 CTGGGCGGGTGGTAGGTGAGTGG - Intergenic
1011404723 6:87006919-87006941 CGGGGGGAGTGGAAGGAGGCAGG + Intronic
1011493375 6:87915348-87915370 ATGTGTGTGTGGAGGGTGGGAGG + Intergenic
1011494443 6:87924778-87924800 CTGGGAGAATAAAAGGTGGGTGG + Intergenic
1011664734 6:89623006-89623028 GTGGGGGAGTGGGGGGTGGGGGG + Intronic
1012166167 6:95955211-95955233 CTCAGAGGGTGGAAGGTGGGAGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013610355 6:111788869-111788891 GTGGGTGGGAGGGAGGTGGGAGG + Intronic
1014303976 6:119717090-119717112 CTGGGTCAGTGGAGAGTGGAGGG + Intergenic
1014645056 6:123962911-123962933 GTGGGTGAGTGGCAGGTGGCTGG - Intronic
1014663002 6:124197316-124197338 CTGGTGGGGTGGAAAGTGGGAGG - Intronic
1015319245 6:131853668-131853690 GTGTGTGAGGGTAAGGTGGGAGG + Intronic
1015436472 6:133195378-133195400 CTGAAAAAGTGGAAGGTGGGAGG + Intergenic
1015902381 6:138081388-138081410 CGGGGTCAGGGGAAGGGGGGAGG + Intergenic
1016967139 6:149729414-149729436 GTGGGTGACTGGAAGGCGGAAGG + Intronic
1017078084 6:150638422-150638444 CTGGCTGAGTGGTAGGGGGAGGG - Intronic
1017488125 6:154921474-154921496 CTCGGCTAGTGGAAGCTGGGGGG + Intronic
1018176811 6:161184418-161184440 ATGGGGGAGAGGAAGGTGTGTGG + Intronic
1018326707 6:162677980-162678002 ATGGGTGAGTGGAGGGTGGGAGG - Intronic
1018469221 6:164081456-164081478 CATGCTGAGTGGAAGGTGGGGGG - Intergenic
1018631033 6:165822674-165822696 CTGGGTGAGTGATAAGTGAGTGG + Intronic
1018833253 6:167462561-167462583 CTGTGTGCTGGGAAGGTGGGAGG + Intergenic
1019117594 6:169777768-169777790 GTGGGTGGGGGGAAGGGGGGCGG - Intronic
1019510480 7:1415193-1415215 GTGGGTGAATGGAGGGAGGGAGG + Intergenic
1019510510 7:1415289-1415311 GTGGGTGAATGGAGGGAGGGAGG + Intergenic
1019696922 7:2451367-2451389 CTGGGGCAGTGGAAGGTCTGGGG - Intergenic
1019755057 7:2762810-2762832 CTGGGTGTGTGGCGGATGGGAGG - Intronic
1019944557 7:4316319-4316341 CTGAGTGAGTAGCAGGTGGTGGG - Intergenic
1020035193 7:4959756-4959778 GTGGGGGAGCGGAAAGTGGGGGG + Intergenic
1021965821 7:25916819-25916841 GGGGGTGAGTGGATGTTGGGGGG - Intergenic
1022460105 7:30596373-30596395 TTTGTGGAGTGGAAGGTGGGTGG - Intronic
1022498182 7:30866219-30866241 CTGGGTGAGTGGATAGGGGCAGG - Intronic
1022539178 7:31120787-31120809 CTGGCTGAGAGGAAGGTGGCTGG + Intergenic
1022828991 7:34045827-34045849 ATGGGTGACTGGAAGATAGGAGG + Intronic
1022830323 7:34059387-34059409 CTGGGGGAGGGGATGGTGGGGGG + Intronic
1023139795 7:37090616-37090638 ATGGCTGTGTGGATGGTGGGAGG - Intronic
1023160614 7:37292773-37292795 CTGGGAGGGAGGGAGGTGGGGGG + Intronic
1023861455 7:44219793-44219815 CTGGGTGGGTTGCAGGTGGATGG - Intronic
1024061145 7:45699602-45699624 CTGGGGGACGGGAGGGTGGGAGG + Intronic
1024202951 7:47125127-47125149 CTTGCAGAGAGGAAGGTGGGAGG - Intergenic
1025248962 7:57338871-57338893 CTGGGTTGGTGGCAGGTTGGGGG + Intergenic
1025776310 7:64563707-64563729 CTGGGTGCATGGAATGTGGCTGG - Intergenic
1025777762 7:64574068-64574090 CTGGGTGCTTGGAATGTGGCTGG + Intergenic
1026113591 7:67477817-67477839 ATTGGAGGGTGGAAGGTGGGAGG - Intergenic
1026401559 7:70019258-70019280 TTTGGAGGGTGGAAGGTGGGAGG + Intronic
1026946290 7:74318288-74318310 CTGGGTGACTTGGAGGTGTGCGG + Intronic
1027053150 7:75032215-75032237 CTGGGAGTGGGGACGGTGGGGGG + Intronic
1028354138 7:89886169-89886191 ATCGGTGGGTGGAGGGTGGGAGG - Intergenic
1028557292 7:92137664-92137686 CTTGGTGGGTGGGAGTTGGGGGG + Intronic
1029609409 7:101618723-101618745 CTGCGTGAGAGGCTGGTGGGAGG - Intronic
1030064433 7:105648600-105648622 CTGTGTGTATGGGAGGTGGGGGG - Intronic
1030109405 7:106013671-106013693 CTGGGTGAGGGGAAGGGTAGCGG - Intronic
1030586643 7:111428992-111429014 CTAGGTGGATGGGAGGTGGGTGG + Intronic
1032156091 7:129469499-129469521 CTTTGTCAGTGGGAGGTGGGTGG + Intronic
1032667279 7:134049296-134049318 ATGGGTGAGTGGAAGGATGAAGG - Intronic
1032908644 7:136403526-136403548 CTGGGTGAGTGGTGAGTGAGTGG - Intergenic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033281474 7:140009576-140009598 GTGGGTGTGGGGAAGGTGTGGGG - Intronic
1033628997 7:143139053-143139075 CCTGGTGAGGAGAAGGTGGGAGG - Exonic
1034221086 7:149446792-149446814 GTGGGTGAGGAGCAGGTGGGAGG - Intronic
1034401777 7:150866474-150866496 GTTGGAGAGTGGAGGGTGGGAGG + Intergenic
1034423649 7:151001798-151001820 CTGCGGGAGAGGAAGGTGTGAGG - Intronic
1034843642 7:154422741-154422763 ATGGGTGGGTGGGAGGTGGGTGG + Intronic
1035146426 7:156821855-156821877 CTTGGTGAGTAGAAGGTGCTGGG - Intronic
1035425481 7:158769351-158769373 CTGTGTGTGAGAAAGGTGGGTGG - Intronic
1035602119 8:902889-902911 GTGGGTGGGTGGAACGTGTGCGG + Intergenic
1035823510 8:2620151-2620173 CTGTGTGAGAGGGATGTGGGTGG + Intergenic
1035863088 8:3051439-3051461 ATGGGAGGGTGGAGGGTGGGAGG + Intronic
1035863900 8:3060430-3060452 CTTTGTGAGACGAAGGTGGGTGG - Intronic
1036243092 8:7095229-7095251 GTGGGGGGGTGGAGGGTGGGGGG + Intergenic
1036417411 8:8563569-8563591 ATTGGAGAGTGGAGGGTGGGAGG + Intergenic
1036627076 8:10480934-10480956 CAGGTTGAGTGGTAGATGGGGGG + Intergenic
1036793999 8:11742549-11742571 TGGGGTGACTGCAAGGTGGGCGG + Intronic
1037674683 8:21043225-21043247 GTGGGGTGGTGGAAGGTGGGAGG - Intergenic
1037674693 8:21043250-21043272 GTGGGGTGGTGGAAGGTGGGGGG - Intergenic
1037674818 8:21043534-21043556 GTGGGGTGGTGGAAGGTGGGGGG - Intergenic
1037703508 8:21296043-21296065 CTGGGTGAGATGAGGGAGGGAGG - Intergenic
1037751421 8:21684756-21684778 ATGGGTGAGTTGAGGGTGGCTGG + Intergenic
1037768486 8:21785886-21785908 GTGGGTGGGTGGAGGGTCGGGGG - Intronic
1037949078 8:23007143-23007165 CTGAGTGAGGGGGAGCTGGGGGG + Exonic
1038008773 8:23457515-23457537 GTGGGTGAGGGGAGGGCGGGCGG - Intronic
1038031389 8:23644800-23644822 ATCGGAGAGTGGAGGGTGGGAGG - Intergenic
1038970305 8:32626185-32626207 CTTGGGAAGTGGGAGGTGGGAGG + Intronic
1039549188 8:38430738-38430760 GAGGGAGAGTGGATGGTGGGGGG - Intronic
1041536016 8:58926239-58926261 CTGGGTGAGAGGAAGATGGCTGG + Intronic
1042441335 8:68829951-68829973 CTTGCTGAGTGGAATGTGAGGGG + Intergenic
1042835048 8:73072108-73072130 CTGTGTGAGAGGAAGGAGAGGGG + Intronic
1043168972 8:76940018-76940040 ATTGGAGAGTGGAGGGTGGGAGG + Intergenic
1043496318 8:80804671-80804693 CTGTCAGAGTGGGAGGTGGGAGG + Intronic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1045028537 8:98113630-98113652 CTGGTTGACTTGAAGGTAGGTGG - Intronic
1047306824 8:123659313-123659335 ATGGATGGGTGGAAGATGGGTGG - Intergenic
1047663015 8:127059117-127059139 GTGGGTGACTGGCAGATGGGAGG - Intergenic
1047730332 8:127722779-127722801 CAGGGCGAGGGGGAGGTGGGAGG - Intergenic
1048270337 8:133023092-133023114 GTGGGTGAATGGAAGATAGGTGG + Intronic
1048512416 8:135074861-135074883 CAGTGTGCTTGGAAGGTGGGAGG + Intergenic
1048890214 8:138940479-138940501 GGGGGTGGGGGGAAGGTGGGGGG - Intergenic
1049233377 8:141495730-141495752 GTGGATGAGTGGATGATGGGCGG - Intergenic
1049291374 8:141804374-141804396 CTAAGTGAGTGGATGCTGGGCGG - Intergenic
1049320627 8:141994452-141994474 GTGGATGAGTGGATAGTGGGTGG - Intergenic
1049320665 8:141994596-141994618 GGGGGTGAGTGGATGGTGGATGG - Intergenic
1049445691 8:142630339-142630361 ATGGGAGAGTGGAAGGTTAGGGG - Intergenic
1049566241 8:143340595-143340617 AAGGGTGACTGGGAGGTGGGGGG - Intronic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1049718819 8:144106238-144106260 CTGGGTGAGGGTCAGGTGGAGGG + Exonic
1050268792 9:3919480-3919502 TTGGGAGGGTGGAAGATGGGAGG + Intronic
1050432781 9:5578884-5578906 CTTGGGGACTGGAAGGTGGGAGG - Intergenic
1050733926 9:8741509-8741531 CTGTTTGAGTGGAAAGTGGCTGG - Intronic
1051664416 9:19455347-19455369 CTTTGGGAGGGGAAGGTGGGTGG + Intergenic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1052503731 9:29325966-29325988 CTGGATGAGAGGAAGGTTGGAGG - Intergenic
1052728500 9:32258852-32258874 CTGGGTATGGGGTAGGTGGGTGG - Intergenic
1052787859 9:32846372-32846394 CTGGGGTAGTGAAAGCTGGGAGG + Intergenic
1053138482 9:35666628-35666650 TTGGGTGGGTGGAAGAGGGGTGG + Intronic
1053233283 9:36430057-36430079 CTGGGTGAGAGTAGGGTAGGAGG - Intronic
1054763501 9:69023887-69023909 GTGGGAGACTGGCAGGTGGGTGG - Intergenic
1055030142 9:71765926-71765948 CTAGCTGAATGGATGGTGGGTGG + Intronic
1055550320 9:77426924-77426946 CTGGGTGTCTGGAAGTTGTGGGG - Intronic
1055872650 9:80902085-80902107 GTGGGTCAGGGGAAGGAGGGAGG + Intergenic
1056110231 9:83388027-83388049 CTGAGTGAGACGAAGGTGGCAGG - Intronic
1056319376 9:85421951-85421973 CTGGGTGAAGGGAAGTTTGGTGG + Intergenic
1056740987 9:89255278-89255300 CTGGGGGAATTGGAGGTGGGAGG - Intergenic
1057297507 9:93857988-93858010 ATGGGTAAGTGGATGATGGGTGG + Intergenic
1057353390 9:94317982-94318004 CCTTGTGAGTGGATGGTGGGAGG + Intergenic
1057654361 9:96939610-96939632 CCTTGTGAGTGGATGGTGGGAGG - Intronic
1057793934 9:98142662-98142684 CTGAGTCTGTGGGAGGTGGGAGG - Intronic
1057893585 9:98888464-98888486 CTGGCTGAGGGGAAGATGAGAGG - Intergenic
1058098371 9:100889291-100889313 CTGGGTGGGGGGATGGAGGGAGG - Intergenic
1058142884 9:101376655-101376677 GTGCGTGAGTGGGAGGTGGCAGG - Intronic
1058346530 9:103970190-103970212 GTGAGAGAGGGGAAGGTGGGGGG - Intergenic
1058655556 9:107217363-107217385 CTGGGAGAGATGAAGATGGGAGG + Intergenic
1058657838 9:107240570-107240592 CTTTGTGAGGGGGAGGTGGGTGG + Intergenic
1058745479 9:107986504-107986526 GTGGGTGACTGGCAGGTTGGTGG + Intergenic
1058914624 9:109553777-109553799 CTTGGTGAATGGATGATGGGTGG + Intergenic
1059299158 9:113298728-113298750 CTGGGTGAGTAGGATGTGGAGGG - Exonic
1059392409 9:114007518-114007540 CTGGGTAAGAGGGAGGAGGGAGG - Intronic
1059416534 9:114166057-114166079 CTGGCTGGATGGATGGTGGGTGG - Intronic
1059718375 9:116934610-116934632 TTCAGGGAGTGGAAGGTGGGAGG + Intronic
1059734589 9:117088510-117088532 CTGTGTGTGTTGGAGGTGGGAGG + Intronic
1060224299 9:121781965-121781987 CTGGGTGAGTGAAAGGAAAGCGG - Intronic
1060296142 9:122344198-122344220 GTTGGAGGGTGGAAGGTGGGAGG + Intergenic
1060304879 9:122402406-122402428 ATGGGGGAGTGGAGGGTGGTAGG + Intergenic
1060368377 9:123043634-123043656 GGGGGTGAGGGGAAGGAGGGTGG + Intronic
1060876667 9:127088934-127088956 CTGGCTTAGTGGAAGGTGTTGGG + Exonic
1060989267 9:127838887-127838909 GTGGGTGGGTGGTAGATGGGCGG - Intronic
1061164142 9:128912723-128912745 TGGGGTGAGTGAGAGGTGGGAGG + Intronic
1061256519 9:129456734-129456756 GTGGGTGAATGGAGGGTGGATGG + Intergenic
1061387889 9:130301200-130301222 GTAGGGGAGTGGAAGCTGGGAGG - Intronic
1061932261 9:133839153-133839175 GTGGATGAGTGGTAGATGGGTGG + Intronic
1062092378 9:134685208-134685230 ATGGGTGAATGGATGGTGGATGG - Intronic
1062092411 9:134685356-134685378 ATGGGTGAATGGATGGTGGATGG - Intronic
1062385446 9:136309184-136309206 CTGGGTGGGTGGCAGGGTGGGGG + Intergenic
1062530044 9:136995758-136995780 CTGGGTGGGTGGAGCGGGGGTGG + Intronic
1062637384 9:137498681-137498703 CTGGGTGGGTGGAGGGTGGCTGG + Intronic
1062649735 9:137569419-137569441 CTGGATGGATGGATGGTGGGTGG - Intronic
1062649862 9:137569902-137569924 GTGGGTGAGTGGATGGATGGTGG - Intronic
1203463900 Un_GL000220v1:68262-68284 CTGGGGGGGAGGGAGGTGGGCGG - Intergenic
1185455470 X:308157-308179 CTGGGTGGGTGGGTGGTGGTTGG - Intronic
1185471016 X:383246-383268 CTTGCTGAGTGAGAGGTGGGTGG - Intronic
1185599286 X:1327857-1327879 CACGGTGGGTGGAGGGTGGGGGG + Intergenic
1185638963 X:1575827-1575849 ATGGGTAAGTAGAAAGTGGGTGG + Intergenic
1185689207 X:2139442-2139464 ATGGGTGAATGGCAGGTGGATGG - Intergenic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1186389044 X:9139847-9139869 ATTGGAGAGTGGAAGGTGGGAGG + Intronic
1186593782 X:10959125-10959147 ATGGGGGGGTGGCAGGTGGGTGG - Intergenic
1187661721 X:21554478-21554500 TTTGGAGGGTGGAAGGTGGGAGG - Intronic
1187788622 X:22922446-22922468 ATTGGAGGGTGGAAGGTGGGAGG - Intergenic
1188024266 X:25192587-25192609 CTGGGTGTGAGGAATGTGGGTGG + Intergenic
1188228014 X:27625854-27625876 ATTTGTGAGTGGAGGGTGGGAGG + Intronic
1188246067 X:27837133-27837155 TTTGGAGAGTGGAGGGTGGGAGG + Intergenic
1188644012 X:32541645-32541667 ATTTGAGAGTGGAAGGTGGGAGG + Intronic
1188721346 X:33527227-33527249 ATCGGTGGGTGGAAGGTGGGAGG + Intergenic
1189065656 X:37805703-37805725 TTGGGTGAGTGGAGGGGGTGGGG - Intronic
1189250768 X:39599369-39599391 CAGGGTGAGTGTAGGGTTGGTGG - Intergenic
1189573931 X:42329733-42329755 CTCAGAGCGTGGAAGGTGGGAGG + Intergenic
1189657536 X:43261416-43261438 TTGGGAGGGTGGAGGGTGGGAGG - Intergenic
1190759407 X:53427171-53427193 CTAGGTGAGTGGATAGAGGGGGG + Intronic
1190830670 X:54056509-54056531 CTGTGGGAGTTCAAGGTGGGAGG - Intergenic
1191085491 X:56563552-56563574 CTGGGGGAGGGGAAGGGGCGGGG + Intergenic
1191750377 X:64535881-64535903 CTGGGGGAGAGGAAGCTGGAAGG + Intergenic
1192226458 X:69231515-69231537 ATGGGGGAGTGGAAGGCAGGTGG + Intergenic
1192305468 X:69954817-69954839 ATTGGAGGGTGGAAGGTGGGAGG - Intronic
1192824048 X:74676127-74676149 TTAGGAGGGTGGAAGGTGGGAGG + Intergenic
1192922805 X:75724834-75724856 GGGGGTGAGTGGAAGCAGGGTGG - Intergenic
1193250689 X:79288232-79288254 ATGGGTGAGTGGAATGGGCGAGG + Intergenic
1193308699 X:79979743-79979765 ATGGGAGGGTGGAAGGTGGAAGG - Intergenic
1193386856 X:80883106-80883128 CTAAGTGCGTGGAAGCTGGGTGG + Intergenic
1193449832 X:81652040-81652062 TTTGGAGTGTGGAAGGTGGGAGG + Intergenic
1193464032 X:81825424-81825446 ATTGGAGAGTGGAGGGTGGGAGG - Intergenic
1194172560 X:90605640-90605662 ATCGGAGGGTGGAAGGTGGGAGG - Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196402433 X:115330491-115330513 CGGGGGGAGGGGGAGGTGGGCGG + Intergenic
1197136765 X:123069725-123069747 ATGGGAGGGTGGAGGGTGGGAGG + Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1198037604 X:132817176-132817198 CTTATTGAGGGGAAGGTGGGGGG - Intronic
1198540974 X:137639440-137639462 GAGGGTGGGTGGAAGGTTGGGGG + Intergenic
1198577474 X:138025910-138025932 TTGGGTGAGTGCAAGCTGTGTGG + Intergenic
1199395323 X:147330608-147330630 AGGGGTCAGTGGAAGGGGGGCGG - Intergenic
1199752301 X:150831592-150831614 ATTGGAGAGTGGAGGGTGGGAGG + Intronic
1200064942 X:153499784-153499806 CTGGGAGAGTGGCAGGGGGCAGG + Intronic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200230198 X:154440136-154440158 ATGAGTGAGGGGAAGCTGGGTGG + Exonic
1200518787 Y:4183377-4183399 ATCGGAGGGTGGAAGGTGGGAGG - Intergenic
1200774802 Y:7160643-7160665 TTGGGAGGCTGGAAGGTGGGAGG - Intergenic
1201147124 Y:11071038-11071060 TTGGGTGGGTGGGGGGTGGGGGG + Intergenic
1201601268 Y:15730801-15730823 CTGGGTGGGGGGTAGGTGGCAGG + Intergenic
1201711682 Y:16999644-16999666 TTTGGTAAGTGGATGGTGGGTGG + Intergenic
1202333982 Y:23786434-23786456 CTGGGTGACTAGAAGCTAGGAGG - Intergenic
1202536786 Y:25883625-25883647 CTGGGTGACTAGAAGCTAGGAGG + Intergenic