ID: 986607860

View in Genome Browser
Species Human (GRCh38)
Location 5:9540297-9540319
Sequence TATGGAGAGAAGGCCGGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 994
Summary {0: 1, 1: 0, 2: 17, 3: 123, 4: 853}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986607860 Original CRISPR TATGGAGAGAAGGCCGGGCG CGG Intronic
900007944 1:76882-76904 AACGGAAAGTAGGCCGGGCGTGG + Intergenic
900253550 1:1684463-1684485 TAAGAATAGGAGGCCGGGCGCGG + Intronic
900332068 1:2140360-2140382 TATGAGCAGGAGGCCGGGCGCGG + Intronic
901258036 1:7848805-7848827 GATGTACAGAAGGCCGGGTGCGG - Intronic
901837699 1:11934858-11934880 GAGGGAGCGAAGGCCGGGGGCGG + Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902069303 1:13720343-13720365 TATGGAGAGAAGGGCTGGGTAGG + Intronic
902091143 1:13904169-13904191 GAGGGGCAGAAGGCCGGGCGAGG + Intergenic
902373605 1:16019758-16019780 GATGGAGAGAGGGTGGGGCGGGG + Intronic
902474496 1:16674421-16674443 TAAAGAAAAAAGGCCGGGCGCGG + Intergenic
902811711 1:18891735-18891757 CATGAAGAGAAGGCCCGGCATGG + Intronic
903080570 1:20808389-20808411 AATGAAGAGGTGGCCGGGCGCGG + Intronic
903234945 1:21944096-21944118 TATTGTGTGCAGGCCGGGCGCGG - Intergenic
903403509 1:23076679-23076701 TATCCAGGGAAGGCCGAGCGTGG + Intronic
903465938 1:23552872-23552894 TAGGTATAGGAGGCCGGGCGCGG + Intergenic
903492109 1:23737115-23737137 TATGGAGTGCTGGCCAGGCGTGG + Intergenic
904100252 1:28019990-28020012 TATGGAGAAGTAGCCGGGCGTGG - Intronic
904154551 1:28471919-28471941 TAGAGACAGTAGGCCGGGCGCGG + Intronic
904373720 1:30066477-30066499 CATGGAGAGTAGGCTGGGAGCGG - Intergenic
904476449 1:30768094-30768116 AATGGTGAAAAGGCCGGGTGTGG - Intergenic
904517337 1:31066306-31066328 AATAGATTGAAGGCCGGGCGCGG + Intergenic
904841763 1:33376638-33376660 TCTACAGAGAAGGCCGGGTGCGG + Intronic
904946650 1:34203962-34203984 TCTGGAGAGAAGCCAGTGCGAGG - Intronic
905673164 1:39806501-39806523 TAAAGAGAGACTGCCGGGCGAGG - Intergenic
905782217 1:40721878-40721900 TAAGAATTGAAGGCCGGGCGCGG + Intronic
905784030 1:40738190-40738212 AAAAGAGAGAGGGCCGGGCGCGG - Intronic
906031484 1:42723796-42723818 GTTGGAGAGAAAGCCGGGGGCGG + Intergenic
906170819 1:43723397-43723419 AGAGGAGGGAAGGCCGGGCGTGG - Intronic
906258995 1:44372121-44372143 AATGGAGACACGGCCGGGTGTGG + Intergenic
906341904 1:44987793-44987815 TACTGCGAGCAGGCCGGGCGTGG + Intergenic
906362609 1:45176553-45176575 AATGTAGACCAGGCCGGGCGCGG - Intronic
906429289 1:45741916-45741938 TATGAAAATAAGGCTGGGCGCGG - Intronic
906606194 1:47174037-47174059 TATTGCAAGCAGGCCGGGCGCGG + Intergenic
907169665 1:52450973-52450995 TACAGAGAGTAGGCTGGGCGCGG + Intronic
907532490 1:55115226-55115248 AAAGGAAACAAGGCCGGGCGCGG + Intronic
908244964 1:62220607-62220629 TATGAAAAGTAGGCCGGGCATGG + Intergenic
908265221 1:62372089-62372111 TATGTAAGGATGGCCGGGCGCGG - Intergenic
908304013 1:62792283-62792305 TGAGTAGATAAGGCCGGGCGTGG - Intronic
908546629 1:65168580-65168602 TATGGAGAGCAGGCCAGATGTGG - Intronic
908645917 1:66277682-66277704 AATGCATATAAGGCCGGGCGTGG - Intronic
908697306 1:66857874-66857896 TGTGGGCAGAAGGCCGGGTGCGG - Intronic
908837615 1:68243834-68243856 TATAAAGAGTTGGCCGGGCGTGG + Intergenic
908871952 1:68623586-68623608 AATGGAGAGAAGGTGGGGAGGGG - Intergenic
908993573 1:70125500-70125522 TAAAGAGAGAGGGCCGGGCGCGG + Intronic
909581781 1:77244021-77244043 TATTGAAAGAAGGCCAGGCATGG - Intergenic
909891316 1:81010929-81010951 TAAGAATAGAAGGCCGGGCGCGG + Intergenic
910290512 1:85596066-85596088 GATGGAGAACAGGCTGGGCGTGG + Intergenic
910569699 1:88685008-88685030 TACGGAGGAAAGGCGGGGCGGGG - Intronic
911605484 1:99899908-99899930 AAAAGAAAGAAGGCCGGGCGTGG - Intronic
912051620 1:105536296-105536318 AATGGAGACAGGGCCGGGTGTGG - Intergenic
912076114 1:105878468-105878490 TAGTCAGAGCAGGCCGGGCGTGG + Intergenic
912277786 1:108278757-108278779 TAAGAAGAGTCGGCCGGGCGCGG + Intergenic
912290440 1:108415602-108415624 TAAGAAGAGTCGGCCGGGCGCGG - Intronic
912405851 1:109436976-109436998 TGTAGAGACAAGGCCGGGCAGGG + Intergenic
912685533 1:111759682-111759704 AATGAAGAGCAGGCCGGGCGCGG + Intronic
912828231 1:112925667-112925689 TAAGAAGAGAAGGCCAGGCACGG - Intronic
913145477 1:115985656-115985678 AAGAGAGAGAAGGCCGGGCGCGG + Intronic
913715501 1:121530256-121530278 TATGGACAGGAAGCCAGGCGGGG - Intergenic
914357193 1:146897026-146897048 CAGGGAGTGAAGGCCAGGCGCGG + Intergenic
914394830 1:147255515-147255537 TATGAAAAATAGGCCGGGCGCGG - Intronic
914475084 1:148015602-148015624 AATAGAGAGAAGGCCGGGCGCGG - Intergenic
914749118 1:150521089-150521111 TATGAAAATGAGGCCGGGCGTGG - Intergenic
915193184 1:154169124-154169146 TTTGGAGGCATGGCCGGGCGCGG - Intronic
915457840 1:156052612-156052634 AATGGAGATACGGCTGGGCGTGG - Intronic
915499342 1:156304105-156304127 TGAGGAAAAAAGGCCGGGCGCGG + Intergenic
915502019 1:156325871-156325893 GATCAAGAGAAGGCCAGGCGTGG - Intronic
916318161 1:163473335-163473357 GATGGAGAGAAGCCAGGGCCCGG - Intergenic
916367519 1:164048526-164048548 TAATGTAAGAAGGCCGGGCGCGG - Intergenic
916372123 1:164109927-164109949 TACTGAGGGAGGGCCGGGCGCGG - Intergenic
916497698 1:165360028-165360050 AATGCACACAAGGCCGGGCGTGG - Intergenic
916701322 1:167298871-167298893 TATGGAAGGAAGGCTGGGCACGG + Intronic
916797643 1:168181500-168181522 TATGGAGAGGAGGCCGGGTGCGG - Intronic
917083933 1:171286380-171286402 AATGGAGAGAAAGCAGGGAGAGG + Intergenic
917296175 1:173521907-173521929 AATGCAGAAAAGGCCGGGCGCGG + Intronic
917849232 1:179046358-179046380 TATAAAGAGATGGCCGGGCACGG + Intronic
917871981 1:179250119-179250141 GATGGAGTCTAGGCCGGGCGCGG - Intergenic
918223031 1:182453488-182453510 GATGGAGAGAAGGCCATGTGAGG + Intronic
918300572 1:183200098-183200120 AATAGAAAGAGGGCCGGGCGCGG + Intronic
918371828 1:183868823-183868845 TATCCAGAGCTGGCCGGGCGTGG + Intronic
919625776 1:199908848-199908870 AATAGAGAGAAAGCCAGGCGTGG + Intergenic
919888690 1:201954418-201954440 TATGGGGACCAGGCCGGGCGTGG - Intergenic
920132995 1:203747053-203747075 GATGGAGGGCAGGCTGGGCGTGG - Intergenic
920396662 1:205651499-205651521 AAATGATAGAAGGCCGGGCGCGG + Intergenic
920676057 1:208039548-208039570 TATGGACAGAAGGCAGAGCAAGG + Intronic
921126584 1:212183257-212183279 TAGGGTGAGTGGGCCGGGCGTGG - Intergenic
921148008 1:212377815-212377837 TTTGGAGAGGAGGCAGGGAGTGG - Intronic
921669689 1:217912245-217912267 TGAGGAAAGAAGGCCAGGCGCGG + Intergenic
921963289 1:221058904-221058926 TAAGGAGAGATGGCTGGGCAGGG + Intergenic
922433003 1:225574609-225574631 TATAAAAAAAAGGCCGGGCGCGG + Intronic
923005434 1:230045673-230045695 TCTTGGGAGGAGGCCGGGCGCGG + Intergenic
923095913 1:230775029-230775051 TGGAGAGAGAAGGCTGGGCGTGG - Intronic
923413586 1:233733374-233733396 TTTGGGCAAAAGGCCGGGCGCGG + Intergenic
923788982 1:237094879-237094901 TAGGAAGACAAGGCCGGGTGCGG - Intronic
924078499 1:240366839-240366861 CAGGGATAGAGGGCCGGGCGCGG - Intronic
924473201 1:244361517-244361539 AATGTAGAACAGGCCGGGCGCGG - Intronic
924576776 1:245287791-245287813 TAAAGAGATCAGGCCGGGCGCGG - Intronic
924637924 1:245806618-245806640 AAGAGGGAGAAGGCCGGGCGCGG + Intronic
924740955 1:246794035-246794057 GGTGGGGAGAAGGCAGGGCGGGG + Intergenic
1063159580 10:3409382-3409404 GATGGAGAGAAGGCCCAGTGAGG + Intergenic
1063442583 10:6085068-6085090 TAATGAAAGAAGGCTGGGCGCGG - Intergenic
1064011710 10:11741598-11741620 AATGGAAAGACGGCTGGGCGCGG - Intergenic
1064056919 10:12105803-12105825 TGTGGTGATGAGGCCGGGCGTGG + Intronic
1064142543 10:12802808-12802830 AATGAAGAGCAGGCCGGGGGCGG - Intronic
1064144695 10:12818378-12818400 AATAGAGAGATGGCCGGGAGTGG + Intronic
1064199040 10:13269309-13269331 TTTAAAGAAAAGGCCGGGCGTGG + Intergenic
1064294329 10:14064866-14064888 TAAGCAGAGAGGGCTGGGCGCGG - Intronic
1064649234 10:17491518-17491540 AATGTAGTCAAGGCCGGGCGCGG + Intergenic
1065371935 10:24996155-24996177 TATGTTGAGGAGGCCGGGCACGG + Intronic
1065479229 10:26176002-26176024 ACTGGAAAGAAGGCCGGGCGCGG + Intronic
1065709465 10:28501587-28501609 TAATGAAAAAAGGCCGGGCGCGG - Intergenic
1065776539 10:29125575-29125597 TGTGGAAAATAGGCCGGGCGTGG - Intergenic
1066076902 10:31887945-31887967 TAGGAAGGGCAGGCCGGGCGCGG - Intronic
1067404773 10:46011563-46011585 TATGCAGACAGGGCCGGGCGTGG - Intronic
1067534836 10:47101426-47101448 AATGGTCAGAAGCCCGGGCGGGG + Intergenic
1067729444 10:48799484-48799506 TAAGGAGAAACGGCCGGGCTTGG + Intronic
1067797964 10:49334366-49334388 TATGGAGAGATGGTCTGGAGGGG + Intergenic
1067959409 10:50831436-50831458 AATGGGCAAAAGGCCGGGCGTGG + Intronic
1068234467 10:54215749-54215771 TATGTCGAGACGGCCGGGCGCGG + Intronic
1068323776 10:55456292-55456314 TATGGAGAGAGGGACTGGAGAGG + Intronic
1068710464 10:60127985-60128007 TATGAAGAACTGGCCGGGCGCGG - Intronic
1068795164 10:61071326-61071348 TATGGATTTAAGGCTGGGCGCGG + Intergenic
1068845346 10:61665595-61665617 TATCTAGGGAAGGCCGGGCGCGG + Intronic
1068978738 10:63038284-63038306 TACAAAGAGAAGGCTGGGCGCGG + Intergenic
1069036264 10:63648936-63648958 AGTGGAGAGGAGGCCGGGTGTGG + Intergenic
1069389484 10:67918626-67918648 CATGGAGAAAAGGCAGGGCAGGG + Intergenic
1069480559 10:68777928-68777950 TCTGAAAAGAAGGCCGGGTGCGG + Intronic
1069505165 10:68990978-68991000 TATGTAGAAAAGGCCGGATGTGG + Intronic
1069923604 10:71832738-71832760 TATCAAGAGAGGGCCGGGCCGGG + Intronic
1070270013 10:74944518-74944540 TATGCAAATTAGGCCGGGCGCGG + Intronic
1070273342 10:74979866-74979888 TTTGAAGAGAAGGCCAGGCCCGG + Intronic
1070611186 10:77933890-77933912 TACGGAGAGTAGGCCGGGCACGG + Intergenic
1071364930 10:84889945-84889967 AATATACAGAAGGCCGGGCGCGG + Intergenic
1071534274 10:86414843-86414865 AATGGAGTTAAGGCCGGGCGCGG - Intergenic
1072149340 10:92673111-92673133 TATGGACAGTAGGCCAGGCGCGG - Intergenic
1072151013 10:92683814-92683836 AATGGATGGTAGGCCGGGCGCGG + Intergenic
1072819727 10:98544418-98544440 GAACTAGAGAAGGCCGGGCGCGG + Intronic
1073251757 10:102124351-102124373 AAAAGAAAGAAGGCCGGGCGCGG - Intergenic
1073343500 10:102764102-102764124 AATACAGAGAAGGCCGGGCGTGG - Intronic
1074499195 10:114007439-114007461 AATGGAAAGAAGGCTGGGCGTGG - Intergenic
1074802952 10:117020197-117020219 AATAGAGAGAAGTCCGGGCACGG + Intronic
1075037002 10:119077841-119077863 AATTCAGAGGAGGCCGGGCGTGG - Intronic
1075092097 10:119449508-119449530 TATAAAGAGTAGGCCGGGCACGG + Intronic
1075987279 10:126798855-126798877 TCTGGAGAGAATGCCAGGCCTGG + Intergenic
1076603347 10:131673626-131673648 GATGGATGGACGGCCGGGCGTGG + Intergenic
1076745851 10:132513213-132513235 TATTAAGAATAGGCCGGGCGTGG + Intergenic
1076790819 10:132775817-132775839 CACGGAGAGAAGCCAGGGCGTGG - Intronic
1076910563 10:133386313-133386335 TTTGCAGAAAAGGCCGGGCGTGG - Intronic
1077027486 11:447610-447632 GTGGCAGAGAAGGCCGGGCGCGG - Intergenic
1077051918 11:570574-570596 AAAAGAGAGAAGGCCGGGCGCGG + Intergenic
1077054225 11:582812-582834 TCTTGAAAAAAGGCCGGGCGCGG - Intronic
1077313632 11:1905415-1905437 AAAAGAGAGAAGGCCGGGCGCGG - Intergenic
1077546143 11:3170862-3170884 TATGGAGAGAACCCTGGGCAAGG + Intergenic
1077815962 11:5685580-5685602 TATCTGGAGAGGGCCGGGCGCGG + Intronic
1077990628 11:7407668-7407690 TATAGACTTAAGGCCGGGCGCGG - Intronic
1079065453 11:17287379-17287401 TATGGTATTAAGGCCGGGCGTGG + Intronic
1079101556 11:17545041-17545063 TATCCAGAGAAGGCCGGGCGCGG - Intergenic
1079766595 11:24401625-24401647 TAAGAAAACAAGGCCGGGCGCGG + Intergenic
1079786642 11:24681269-24681291 TAAGGAAATTAGGCCGGGCGCGG - Intronic
1079978644 11:27124812-27124834 TAAAGAAAGAAGGCCGGGCACGG - Intronic
1080474142 11:32574049-32574071 TAAGGATAGAAGGCTAGGCGTGG - Intergenic
1081220690 11:40456878-40456900 CATGGAGATAAGGGCGGGAGGGG + Intronic
1081959047 11:47119899-47119921 GATGGGGATAAGGCCGGGCATGG - Intronic
1081985337 11:47298076-47298098 TATGTAAAGAAGGCCGGGCGCGG - Intronic
1083355182 11:62060926-62060948 TAAAGAGAGATGGCTGGGCGCGG - Intergenic
1083560081 11:63666327-63666349 AATAGAGGGTAGGCCGGGCGCGG - Intronic
1083604054 11:63966851-63966873 AATGGAAAGGAGGCTGGGCGCGG + Intergenic
1083620613 11:64047604-64047626 GAGGGAAGGAAGGCCGGGCGCGG + Intronic
1083627900 11:64081310-64081332 TATGAAGTGTAGGCTGGGCGTGG - Intronic
1084224710 11:67708730-67708752 TATAGAGCTGAGGCCGGGCGTGG - Intergenic
1084262529 11:67988595-67988617 TATAGAGCTGAGGCCGGGCGTGG - Intergenic
1084347215 11:68561384-68561406 TATTCAGAGAAAGCTGGGCGAGG - Intronic
1084560049 11:69899591-69899613 TATGAAAATAAGGCCGGGCATGG + Intergenic
1084664159 11:70567336-70567358 GCTGGAGATGAGGCCGGGCGTGG + Intronic
1084804513 11:71569595-71569617 GGTGGCGAGAAGGCCGAGCGGGG + Intergenic
1084805942 11:71579033-71579055 GGTGGCGAGAAGGCCGAGCGGGG - Intergenic
1085102373 11:73812174-73812196 TTGGGAAAGAGGGCCGGGCGCGG - Intronic
1085333703 11:75673545-75673567 AATGCAAAGATGGCCGGGCGCGG + Intergenic
1085413907 11:76307640-76307662 TGTGGGGAGCAGGGCGGGCGGGG + Intergenic
1085985953 11:81788590-81788612 AATAGACAGCAGGCCGGGCGCGG - Intergenic
1086027160 11:82308019-82308041 TAATGGGAGACGGCCGGGCGCGG + Intergenic
1086440381 11:86823714-86823736 AATTCAGAGCAGGCCGGGCGCGG + Intronic
1086905587 11:92414718-92414740 TCTGAAGAATAGGCCGGGCGTGG + Intronic
1087814314 11:102641722-102641744 TAAAGTGAGAAGGCCGGGTGTGG + Intergenic
1087990860 11:104744253-104744275 TAGAAAGCGAAGGCCGGGCGCGG + Intergenic
1088619645 11:111668911-111668933 TGTGGAGAGAGGGCAGGGTGTGG + Intronic
1088894425 11:114067058-114067080 AAGTGAGTGAAGGCCGGGCGGGG - Intronic
1089350935 11:117821349-117821371 AAGAGAGAGAAGGCTGGGCGTGG - Intronic
1089473904 11:118743001-118743023 TAAGGCTAGAAGGCCGGGCCTGG + Intergenic
1089485324 11:118841158-118841180 GAGGGAAATAAGGCCGGGCGTGG + Intergenic
1089618675 11:119709745-119709767 TGTGGAGAGAGGGCAGGACGAGG + Intronic
1090040300 11:123284912-123284934 AATGAAGATGAGGCCGGGCGCGG + Intergenic
1090365496 11:126201908-126201930 AATGGAGAAGAGGCTGGGCGCGG - Intergenic
1090388035 11:126367855-126367877 TATGCATAGCAGGCCGGGTGTGG + Intronic
1090784192 11:130033905-130033927 TATAAAGAGTAGGCTGGGCGTGG - Intergenic
1091279715 11:134374948-134374970 TGTGGAGAGAGGGCCCGGCTGGG - Intronic
1091549485 12:1527267-1527289 GATGCACAGAAGGCCTGGCGCGG - Intergenic
1091634227 12:2185306-2185328 TATGGAGAGTAGACGGGGTGGGG - Intronic
1092153226 12:6265580-6265602 TATGAAGAAGCGGCCGGGCGTGG + Intergenic
1092404572 12:8210005-8210027 TGGGGAAGGAAGGCCGGGCGCGG - Intergenic
1092451109 12:8603119-8603141 GAAAGAGAGAGGGCCGGGCGTGG - Exonic
1092824986 12:12390494-12390516 TATGGTCAGAAAGCCGGGGGTGG + Intronic
1092864714 12:12750080-12750102 TTGGGAAAGATGGCCGGGCGCGG + Intronic
1093060318 12:14595384-14595406 TAACCAGAGATGGCCGGGCGTGG - Intergenic
1093462488 12:19419297-19419319 TATGGAAAATAGGCCGGGTGCGG + Intronic
1093953803 12:25194108-25194130 TAGGGAGTGGAGGCCTGGCGCGG - Intronic
1095073213 12:37883324-37883346 ACTGGAAAGAAGGCCGGGCGCGG - Intergenic
1095221692 12:39623385-39623407 AACTGAAAGAAGGCCGGGCGCGG - Intergenic
1095732319 12:45519566-45519588 TATGGAAACAAGTCCGGGCGTGG + Intergenic
1095966280 12:47869244-47869266 TAGGAAGAGAAGGCCGGGCGCGG + Intronic
1096141869 12:49249135-49249157 AATAAAAAGAAGGCCGGGCGCGG + Intronic
1096374561 12:51097724-51097746 TATGGTAAGATGGCCAGGCGTGG + Intronic
1096492943 12:52023042-52023064 AATGGAGAGGAGGCGGGGCTGGG + Intronic
1096517172 12:52163362-52163384 AATGAAGAGTAGGCCGGGCGCGG + Intergenic
1096615570 12:52831382-52831404 TGAGGAGAGCAGGCCAGGCGGGG - Intronic
1096641091 12:52994991-52995013 AATGAAAAGAAGGCTGGGCGTGG - Intergenic
1096682684 12:53267317-53267339 AAAGAAAAGAAGGCCGGGCGCGG - Intergenic
1097012141 12:55960835-55960857 AACACAGAGAAGGCCGGGCGCGG - Intronic
1097252551 12:57644376-57644398 GATACAGAGAGGGCCGGGCGTGG - Intergenic
1097262793 12:57728867-57728889 TATCGGGAGAAGGCCGGGCACGG + Intronic
1097890740 12:64774800-64774822 TATGGAAAGAAGGCCGGGCATGG + Intergenic
1098269826 12:68759017-68759039 TAGAAAGAGAGGGCCGGGCGCGG - Intronic
1098390388 12:69963836-69963858 CATCTAGTGAAGGCCGGGCGCGG + Intergenic
1099954280 12:89337659-89337681 GTTGGAGACTAGGCCGGGCGCGG + Intergenic
1099960823 12:89395356-89395378 TGGGGAGGGTAGGCCGGGCGCGG + Intergenic
1100277233 12:93082272-93082294 TATGGAAAGCAGGCCGGGCGCGG + Intergenic
1100292747 12:93233476-93233498 TATGGGTAGTAGGCCAGGCGTGG + Intergenic
1100545597 12:95599063-95599085 TATAGGGAAGAGGCCGGGCGCGG - Intergenic
1100858350 12:98778184-98778206 TATGAACAGTAGGCTGGGCGTGG + Intronic
1101151956 12:101891037-101891059 TGTGGGGGGCAGGCCGGGCGCGG - Intronic
1101325978 12:103716323-103716345 TCTGGAGAGCAGGCTGGGGGAGG + Intronic
1101354472 12:103964406-103964428 TAACGTGAGGAGGCCGGGCGTGG - Intronic
1101689675 12:107065300-107065322 AAAGGAGTAAAGGCCGGGCGCGG + Intronic
1101950570 12:109171638-109171660 TGTAAAGAGAAGGCCAGGCGTGG - Intronic
1102295697 12:111734931-111734953 TAAGGGAAGACGGCCGGGCGCGG + Intronic
1102470100 12:113154877-113154899 GATGGGAAGAATGCCGGGCGCGG + Intronic
1102516752 12:113454111-113454133 AATGAAGAAAAGGCCAGGCGTGG - Intergenic
1102725612 12:115061750-115061772 AATGCAAAGTAGGCCGGGCGTGG + Intergenic
1103019474 12:117522395-117522417 AATGGAGAGAAGGCCAGGGGTGG + Intronic
1103108789 12:118255790-118255812 AATGGACATATGGCCGGGCGCGG + Intronic
1103191146 12:119003169-119003191 TATGGAAAGAAGGCTAGGCTTGG + Intronic
1103202141 12:119096552-119096574 TGTGGAGAGAACGCTGGGCTGGG + Intronic
1103400032 12:120637552-120637574 ACTGGAGAGGAGGCCGGGCATGG - Intergenic
1103448703 12:121012560-121012582 GATGGAGTCAAGGCCGGGCGCGG + Intronic
1103473482 12:121200662-121200684 TCTTAAGAGAAGGCCGGGCACGG - Intergenic
1103552317 12:121746662-121746684 AATGAGAAGAAGGCCGGGCGTGG + Intronic
1103607985 12:122101867-122101889 CTTGAAGAGAAGGCCGGGCGCGG - Intronic
1103685881 12:122731551-122731573 AATGGGGTGGAGGCCGGGCGCGG + Intergenic
1103725158 12:122994161-122994183 AATGCAGAGCTGGCCGGGCGCGG - Intronic
1103756969 12:123215945-123215967 GACCAAGAGAAGGCCGGGCGCGG + Intronic
1103804610 12:123562708-123562730 GAGGGGGAGCAGGCCGGGCGCGG + Intergenic
1103809291 12:123601222-123601244 TGCTGAGTGAAGGCCGGGCGCGG + Intergenic
1104005947 12:124892564-124892586 GAGGGAGAGAGGGCCGGGCACGG - Intergenic
1104095551 12:125554131-125554153 TATCAACAGTAGGCCGGGCGCGG + Intronic
1104201237 12:126591421-126591443 TATGTAAAGAAGGCCAGGGGAGG - Intergenic
1104283665 12:127402797-127402819 TATAGAAATAAGGCTGGGCGTGG - Intergenic
1104569921 12:129916170-129916192 AATGTAGACTAGGCCGGGCGTGG + Intergenic
1104848103 12:131857259-131857281 GAGTGACAGAAGGCCGGGCGTGG - Intergenic
1105526583 13:21183526-21183548 GATGGAGTAAAGGCCGGGCACGG + Intergenic
1106264209 13:28095562-28095584 TTTGGAGAGGGGGCCGGGCAAGG - Intronic
1106368467 13:29107046-29107068 TAGGGATAGAAGGCCGGGGGAGG - Intronic
1106390685 13:29332923-29332945 GAACTAGAGAAGGCCGGGCGCGG - Intronic
1106499713 13:30316233-30316255 TAAGAAAAAAAGGCCGGGCGCGG - Intergenic
1106580653 13:31015620-31015642 AAACGAGAAAAGGCCGGGCGCGG + Intergenic
1106664420 13:31836691-31836713 TATATAAAGAGGGCCGGGCGTGG + Intergenic
1107640739 13:42440796-42440818 TAAGGAAAAGAGGCCGGGCGCGG + Intergenic
1108921597 13:55681394-55681416 AATGTAGAGAAGGCCAGGTGTGG - Intergenic
1109383444 13:61596937-61596959 TAAAGAAAGAAGGCCGGGCGCGG + Intergenic
1111503355 13:89155061-89155083 TTGTAAGAGAAGGCCGGGCGCGG + Intergenic
1111534631 13:89586776-89586798 TATGGAGGGGAGGCTGGGAGTGG + Intergenic
1112338853 13:98536652-98536674 AATGGAGAGAAGGGCAGGTGTGG - Intronic
1112380781 13:98887324-98887346 TATGGATAATAGGCCGGGTGGGG + Intronic
1112394971 13:99021347-99021369 TAAAGAGGGAAGGCCAGGCGTGG + Intronic
1112724134 13:102282342-102282364 TAGGGATAGGAGGCTGGGCGTGG - Intronic
1113111052 13:106823958-106823980 CATGAAGAAGAGGCCGGGCGCGG - Intergenic
1113647860 13:112011635-112011657 GAAGGAGAAGAGGCCGGGCGCGG - Intergenic
1113828785 13:113277947-113277969 AAAGAAGAGAAGGCTGGGCGCGG + Intergenic
1113993421 14:16047090-16047112 TATCAAGAGAAGGCCAGGCAAGG - Intergenic
1114838388 14:26232402-26232424 GAAAGAAAGAAGGCCGGGCGCGG + Intergenic
1115235125 14:31201994-31202016 AGTGGAGAGCCGGCCGGGCGCGG + Intronic
1115311311 14:31981019-31981041 AATGTAGAGAAGGCCGGGCGCGG - Intergenic
1115534411 14:34358929-34358951 TATGAAGAAAAGGCCAGGTGCGG - Intronic
1115553330 14:34524099-34524121 TATAAAAATAAGGCCGGGCGTGG + Intronic
1115754490 14:36518571-36518593 GCTGGAGAGAGGGCCGGGCCGGG + Intronic
1115766910 14:36632401-36632423 TGTGGGGAGGTGGCCGGGCGCGG + Intergenic
1115865428 14:37741578-37741600 TAGTGAGAAAAGGCCAGGCGCGG - Intronic
1115981707 14:39058595-39058617 TACAGAAAGAAGGCCGGGCGCGG - Intronic
1116280507 14:42900845-42900867 AAGGGAGAGGAGGCTGGGCGCGG + Intergenic
1116611588 14:47080019-47080041 TTAGGAGAAAAGGCCGGGCACGG - Intronic
1117059630 14:51948829-51948851 AATTGAGGGATGGCCGGGCGTGG + Intronic
1117099384 14:52331210-52331232 AAGAGAGAGGAGGCCGGGCGCGG + Intergenic
1117382155 14:55174977-55174999 TATGGACAATAGGCTGGGCGCGG - Intronic
1117392843 14:55279004-55279026 GATTTAGTGAAGGCCGGGCGTGG + Intronic
1117783641 14:59259752-59259774 AATTGAGATTAGGCCGGGCGTGG + Intronic
1118776765 14:68978535-68978557 TATGGAGAGGTGGCCAGGGGCGG + Intronic
1119003329 14:70903001-70903023 TTGGAAGAGAAGGCTGGGCGTGG - Intergenic
1119292555 14:73507091-73507113 TAAAGACAGAAGGCCGGGCACGG - Intronic
1119701123 14:76755542-76755564 AGTGCAGAGTAGGCCGGGCGTGG - Intergenic
1119722727 14:76902056-76902078 TGGGGAGAGATGGCTGGGCGAGG + Intergenic
1120005204 14:79348665-79348687 TAAGAAGATTAGGCCGGGCGCGG - Intronic
1120315755 14:82890575-82890597 TATATAGAGGAGGCCAGGCGTGG - Intergenic
1120585597 14:86308443-86308465 TAAGAAGAGAGGGCCGGGCGCGG + Intergenic
1120786222 14:88539536-88539558 AAGGGAAAGAAGGCCAGGCGTGG - Intronic
1121122727 14:91386151-91386173 AAAGTAGAGCAGGCCGGGCGCGG + Intronic
1121243213 14:92444562-92444584 AATGAAGTGAAGGCTGGGCGCGG + Intronic
1121357132 14:93224665-93224687 ACTGTAGGGAAGGCCGGGCGAGG - Intronic
1121440111 14:93943352-93943374 TTTGGATGGAGGGCCGGGCGCGG + Intronic
1121745471 14:96286963-96286985 GATGTCCAGAAGGCCGGGCGCGG + Intronic
1121767265 14:96498687-96498709 AAGGAAGAGAAAGCCGGGCGCGG - Intergenic
1122096700 14:99377653-99377675 AAGGCAGAGGAGGCCGGGCGCGG + Intergenic
1122215126 14:100198449-100198471 AACAGAAAGAAGGCCGGGCGTGG + Intergenic
1122749518 14:103922215-103922237 TATGCAGAGCAGGCCGGGCGCGG - Intronic
1122901353 14:104783591-104783613 TCTGGAGTGAGGGCCTGGCGTGG - Intronic
1123047823 14:105527102-105527124 TACGGAGAGGTGGCCGGGCCGGG + Intronic
1124510473 15:30320069-30320091 GAAACAGAGAAGGCCGGGCGCGG - Intergenic
1124732415 15:32210458-32210480 GAAACAGAGAAGGCCGGGCGCGG + Intergenic
1125332889 15:38599431-38599453 TAGGAAGAGAGGGCTGGGCGTGG - Intergenic
1125587920 15:40834563-40834585 TATGCATAGAGGGCCGGGTGCGG - Intergenic
1125846903 15:42864292-42864314 TGTTCAGAGAAGGCCAGGCGTGG + Intronic
1126414274 15:48401626-48401648 TATGGAGAGGAGGCAGGCTGGGG + Intergenic
1127515573 15:59689807-59689829 TAAGGGGAGGAGGTCGGGCGCGG + Intergenic
1127699499 15:61484266-61484288 AATGTAGAATAGGCCGGGCGCGG - Intergenic
1127784270 15:62342305-62342327 TAAGAAAAGCAGGCCGGGCGCGG + Intergenic
1127928919 15:63577464-63577486 AAAGAAAAGAAGGCCGGGCGTGG + Intronic
1128068395 15:64778044-64778066 AAAGAAAAGAAGGCCGGGCGCGG - Intergenic
1128277492 15:66365833-66365855 TATGCAGAGCAGGCTGGGCGCGG - Intronic
1128367601 15:67015450-67015472 TAAGAAGTGGAGGCCGGGCGCGG - Intergenic
1128799380 15:70487920-70487942 TTTGGAGAGAATGCTGGGCAGGG - Intergenic
1128930613 15:71702024-71702046 GATGGAGAGGAGGCCTGGCAGGG - Intronic
1129260889 15:74366608-74366630 AATTGGGAGAAGGCCGGGTGCGG - Intronic
1130027785 15:80284762-80284784 TAGGGAAAACAGGCCGGGCGAGG - Intergenic
1130550179 15:84885439-84885461 AGTGGAGAAAAGGCCAGGCGCGG + Intronic
1130962706 15:88673858-88673880 TATGAAGATATGGCCGGGCGAGG - Intergenic
1131201228 15:90397804-90397826 TATTGAGTTCAGGCCGGGCGTGG - Intronic
1131563352 15:93463196-93463218 TATTCAGAGCTGGCCGGGCGTGG + Intergenic
1131782759 15:95877413-95877435 TATGAAAACTAGGCCGGGCGTGG + Intergenic
1132445615 15:101915225-101915247 AACGGAAAGTAGGCCGGGCGTGG - Intergenic
1132511466 16:344140-344162 AAGGGAAAAAAGGCCGGGCGTGG + Intronic
1132520576 16:385912-385934 TATTCAGAGTAGGCCGGGCGCGG - Intronic
1132828050 16:1914653-1914675 TTTGGAGAGAAGGCCTGGCAGGG - Intronic
1132839738 16:1973149-1973171 TAGGTAGGGGAGGCCGGGCGCGG + Intronic
1133892985 16:9899146-9899168 AAGGCAGAGAAGGCCAGGCGCGG + Intronic
1134007233 16:10826170-10826192 TAGGAATAAAAGGCCGGGCGTGG + Intergenic
1134133588 16:11665985-11666007 AATGGAGATGAGGCCGGGTGCGG - Intergenic
1134435278 16:14251084-14251106 ACTTGAGAGTAGGCCGGGCGCGG + Intronic
1134542531 16:15079098-15079120 TATGAAGAGGAGGCCGGGCGTGG - Intronic
1134651481 16:15912376-15912398 AAAAGAAAGAAGGCCGGGCGCGG - Intergenic
1134947276 16:18335488-18335510 AATGGAACGATGGCCGGGCGTGG - Intronic
1135016382 16:18927451-18927473 GAAAGAGAGAAGGCCGGGCGTGG + Intergenic
1135079473 16:19421938-19421960 GAGAGAGAGAGGGCCGGGCGCGG + Intronic
1135139192 16:19907321-19907343 GATGAAGAGAGGGCCGGGCACGG - Intergenic
1135198194 16:20412053-20412075 TAAGGAAAGAAGGCCGGGCGCGG + Intronic
1135220036 16:20606515-20606537 TAAGGAAAGAAGGCCGGGCGCGG - Intergenic
1135322018 16:21503307-21503329 GAAAGAGAGAAGGCCGGGCGCGG + Intergenic
1135360108 16:21805176-21805198 TATGAAGAGGAGGCTGGGTGTGG - Intergenic
1135628277 16:24015089-24015111 AATGGAAATAAGGCCAGGCGCGG - Intronic
1136127824 16:28197624-28197646 TATTCAGACTAGGCCGGGCGCGG + Intronic
1136262698 16:29091764-29091786 TATGAAGAGGAGGCCGGGTGTGG + Intergenic
1136333495 16:29596433-29596455 AAGAAAGAGAAGGCCGGGCGCGG + Intergenic
1136551681 16:30985455-30985477 TACGGAGAGAGGGGCGGGCTTGG - Intronic
1137439532 16:48486127-48486149 TATTGGGGAAAGGCCGGGCGTGG - Intergenic
1137639633 16:50017245-50017267 AATGGACAAAGGGCCGGGCGTGG - Intergenic
1137964371 16:52916086-52916108 TATGCAGATTAGGCCGGGAGCGG - Intergenic
1138013583 16:53408469-53408491 TAAGAAGTCAAGGCCGGGCGCGG + Intergenic
1138603009 16:58068676-58068698 AATGAAGTCAAGGCCGGGCGTGG + Intergenic
1138665885 16:58568080-58568102 TCTGTAAAGAAGGCCGGGCACGG + Intronic
1138766733 16:59614118-59614140 CTTGGAGAAAGGGCCGGGCGTGG + Intergenic
1139449859 16:67020807-67020829 TAAAGAGGGAAGGCCGGGCATGG - Intergenic
1139490859 16:67285217-67285239 TATGGGCAGTAGGCAGGGCGGGG + Intronic
1139541604 16:67622064-67622086 TATTTAGTGTAGGCCGGGCGCGG + Intronic
1139611414 16:68061571-68061593 CTTGGAGAGAAGCCCGGGCCAGG + Intronic
1139641570 16:68295578-68295600 TAAGAAGAGAAGGCTGGGCGTGG - Intronic
1139870095 16:70100945-70100967 AATGGAGATGAGGCCGGGCATGG + Intergenic
1139976977 16:70820108-70820130 CAGGGAGTGAAGGCCAGGCGCGG - Intronic
1140098911 16:71897653-71897675 TATTGAGTGGAGGCCGGGCACGG + Intronic
1140217739 16:73022051-73022073 TGTGGAGAGGAGGCGGGACGAGG - Intronic
1140385352 16:74531615-74531637 AATGGAGATGAGGCCGGGCATGG - Intronic
1140392395 16:74598600-74598622 TATATAAATAAGGCCGGGCGCGG + Intronic
1140546525 16:75815280-75815302 TAAAGAAAAAAGGCCGGGCGCGG + Intergenic
1140813783 16:78602520-78602542 TATCGAGAAGAGGCCGGGTGTGG - Intronic
1141065602 16:80911289-80911311 TAAGAAGAGACAGCCGGGCGTGG + Intergenic
1141824626 16:86470465-86470487 TATGAAGATCAGGCCAGGCGTGG + Intergenic
1142554508 17:764716-764738 CATGTTGAGTAGGCCGGGCGCGG + Intronic
1142578152 17:922940-922962 AATGCAGAGTGGGCCGGGCGTGG - Intronic
1142671083 17:1487625-1487647 TCTAGAGGGAGGGCCGGGCGCGG + Intronic
1142708092 17:1709096-1709118 AATGAAGAGAGGGCCGGGGGCGG + Intronic
1142781652 17:2185933-2185955 GATGCAGAGAAGGCTGGGCATGG + Intronic
1142918262 17:3161605-3161627 TAACGAGAAAAGGCCGGGCGCGG - Intergenic
1143000575 17:3792405-3792427 TATAGATATCAGGCCGGGCGCGG - Intronic
1143171131 17:4931208-4931230 AAAGAAGAGAATGCCGGGCGCGG + Intergenic
1144250497 17:13411914-13411936 TATTGAGGGCAGGCCGGGCACGG + Intergenic
1144295816 17:13873937-13873959 TACAGAGAGAAGGCCGTGTGAGG + Intergenic
1144532853 17:16056604-16056626 AATGCTGAGAAGGCCGGGCGTGG - Intronic
1144878049 17:18412524-18412546 GATGAGGACAAGGCCGGGCGCGG + Intergenic
1144995693 17:19266690-19266712 AATGCTGAGATGGCCGGGCGTGG - Intronic
1145154181 17:20531901-20531923 GATGAGGACAAGGCCGGGCGCGG - Intergenic
1145825608 17:27875088-27875110 TCTGGTGAGCAGGCCTGGCGCGG - Intronic
1146374113 17:32282910-32282932 TCTCCACAGAAGGCCGGGCGCGG - Intronic
1147247627 17:39132631-39132653 TGTGGTGAGATGGCCTGGCGGGG + Intronic
1147372529 17:40003062-40003084 AATGGAGAGTCGGCCGGGCATGG + Intergenic
1147379665 17:40046453-40046475 TAAGAAGAAAAGGCCGGGCGCGG + Intronic
1147439997 17:40442272-40442294 GAAAGAAAGAAGGCCGGGCGCGG - Intergenic
1147710153 17:42457989-42458011 AATAAAGAGAGGGCCGGGCGCGG + Intergenic
1147947923 17:44090977-44090999 TGTAAAAAGAAGGCCGGGCGCGG - Intronic
1147962387 17:44176062-44176084 TTAGGAGATAAGGCCGGGTGTGG + Intronic
1148001279 17:44388953-44388975 TGCAGAGAGGAGGCCGGGCGCGG - Intronic
1148710614 17:49678144-49678166 AATGGGGAGGAGGCCGCGCGGGG - Intronic
1148837389 17:50472576-50472598 CAGGGTGAGAAGGCAGGGCGGGG + Exonic
1149134816 17:53352143-53352165 ACTGGGGAGGAGGCCGGGCGCGG + Intergenic
1149266820 17:54935830-54935852 TACACAGTGAAGGCCGGGCGCGG + Intronic
1149301388 17:55307457-55307479 TACTGAGAGAAGGCTGGGCATGG - Intronic
1149743821 17:59075271-59075293 TATACAGAGAAGGCCGGGCACGG + Intronic
1149766369 17:59282124-59282146 TGTGGTAAGAAGGCTGGGCGCGG + Intergenic
1149809384 17:59653481-59653503 GAGGGAGAGGAGGCCGGGCGTGG - Intronic
1150047090 17:61924526-61924548 AAAGTAGAGAAGGCCGGGCACGG + Intronic
1151141828 17:72000544-72000566 AAGGGTTAGAAGGCCGGGCGCGG + Intergenic
1151351721 17:73535867-73535889 TGTGGGGAGAAGGCAGGGGGCGG + Intronic
1151399962 17:73849601-73849623 TAAGAAAAGAAGGCCGGGCGCGG + Intergenic
1151429461 17:74052670-74052692 TATGGAAAGAAAGACGGGAGGGG - Intergenic
1151455708 17:74224707-74224729 TAAAGAGAGAGGGCTGGGCGTGG + Intronic
1151613784 17:75194590-75194612 AAGTGAGATAAGGCCGGGCGCGG + Intergenic
1151812758 17:76454184-76454206 TATAAAAAGTAGGCCGGGCGCGG + Intronic
1151824265 17:76514932-76514954 GAGAGAGAGATGGCCGGGCGCGG + Intergenic
1152018241 17:77766071-77766093 GATTTAGAGCAGGCCGGGCGCGG + Intergenic
1152097825 17:78282162-78282184 TATCGAGATCAGGCCGGGCACGG + Intergenic
1152273283 17:79338227-79338249 TATCTGGAGAAGGCCAGGCGCGG - Intronic
1152329596 17:79664636-79664658 TGGTGAGAGTAGGCCGGGCGCGG - Intergenic
1152395300 17:80029286-80029308 TAAGGAGAGAGGGGCGGGCAGGG + Intronic
1152455913 17:80415945-80415967 TCTGGGGAGTTGGCCGGGCGCGG + Intronic
1152725990 17:81946356-81946378 AAAGAAGAAAAGGCCGGGCGCGG + Intronic
1152842248 17:82577549-82577571 TATGCACAGAGGGCCCGGCGGGG - Intronic
1152868136 17:82736243-82736265 AATGTATGGAAGGCCGGGCGCGG + Intronic
1153294827 18:3535415-3535437 TAGGGAAAAAGGGCCGGGCGTGG + Intronic
1153670374 18:7406186-7406208 TATCAATTGAAGGCCGGGCGCGG - Intergenic
1153765680 18:8372362-8372384 TATAGAGTGGAGGCCGGGCGCGG - Intronic
1153771639 18:8421592-8421614 TAAGGAGAGTAGGCTGGGCATGG - Intergenic
1154167910 18:12029709-12029731 TATGGAATGGAGGCCGGGCATGG - Intronic
1155452912 18:25981599-25981621 AAGGGAGACAAGGCCGGGCACGG + Intergenic
1156335664 18:36169214-36169236 AATGGAGAGCAGGCTGAGCGTGG - Intronic
1156365833 18:36426192-36426214 TAGTGTGTGAAGGCCGGGCGCGG - Intronic
1156721747 18:40078645-40078667 AAAGGAAAGAAGGCCGGGGGTGG + Intergenic
1157868335 18:51205931-51205953 TATGGAAAAAAGGCCAGGTGCGG + Intronic
1157949318 18:52017007-52017029 TATGTGGTGTAGGCCGGGCGCGG + Intergenic
1158108828 18:53917174-53917196 TGTTGAGAGAAGGCCAGGCATGG - Intergenic
1158160564 18:54478306-54478328 AATGAAGAAAAGGCCGGGCATGG - Intergenic
1158743472 18:60169448-60169470 AATGTAGGGATGGCCGGGCGTGG - Intergenic
1158892017 18:61881200-61881222 GAGAGAGAGAAGGCCGGGTGCGG - Intronic
1158970895 18:62665449-62665471 TATGCAGAGTTGGCCGGGCGTGG + Intergenic
1159099261 18:63940217-63940239 TTTGAAGATATGGCCGGGCGTGG + Intergenic
1159582666 18:70250506-70250528 ACTTGAGAGCAGGCCGGGCGCGG + Intergenic
1159945020 18:74438180-74438202 TTTGGAGGGATGGCTGGGCGTGG - Intronic
1160639698 19:118476-118498 AACGGAAAGTAGGCCGGGCGTGG + Intergenic
1160753825 19:747643-747665 GATGGAGAAGAGGCCGGGGGCGG - Exonic
1160784624 19:893883-893905 AATGGAAGAAAGGCCGGGCGCGG - Intergenic
1160934710 19:1588489-1588511 AAGGGAAACAAGGCCGGGCGCGG + Intronic
1161122351 19:2536125-2536147 AAAGAAAAGAAGGCCGGGCGCGG + Intronic
1161206661 19:3044925-3044947 AATGCAGGGAAAGCCGGGCGCGG + Intronic
1161492995 19:4572564-4572586 AGTGGAGGGGAGGCCGGGCGCGG - Intergenic
1161645994 19:5453817-5453839 AAGGGAGAAAAGGCCGGGCATGG - Intergenic
1161958381 19:7508562-7508584 TATGGAGTCAAGGCTGGGCGCGG + Intronic
1162085547 19:8246873-8246895 CATTGGGGGAAGGCCGGGCGCGG + Intronic
1162101941 19:8344006-8344028 AAAGTAGGGAAGGCCGGGCGCGG - Intronic
1162527010 19:11211954-11211976 TATGAAGGGGAGGCGGGGCGGGG + Intronic
1162588928 19:11578322-11578344 GATGGAGAGAGGGCAGGGGGAGG - Intronic
1162799756 19:13103904-13103926 TATGCAGTAAAGGCCGGGCTTGG + Intergenic
1163041389 19:14605384-14605406 TGTGGGGAGGTGGCCGGGCGCGG - Intronic
1163139184 19:15334585-15334607 AATGGAAAGCAGGCTGGGCGCGG + Intergenic
1163264920 19:16214640-16214662 TATGAAAAGAAGGCCGGGTGTGG - Intronic
1163306711 19:16484465-16484487 CATCGAGAGTTGGCCGGGCGTGG - Intronic
1163309700 19:16506263-16506285 TATGAAGACATGGCCAGGCGCGG - Intronic
1163312786 19:16523959-16523981 TAAAGAGAGAAGGCTGGGCATGG + Intronic
1163604794 19:18268086-18268108 TTTGAAAAGCAGGCCGGGCGCGG - Intronic
1163841180 19:19611388-19611410 TAAAAAGAGAAGGCCGGGCATGG + Intronic
1163921183 19:20290388-20290410 AAAGGAGAAGAGGCCGGGCGCGG - Intergenic
1163952013 19:20597456-20597478 AATTAAAAGAAGGCCGGGCGCGG - Intronic
1164438801 19:28255863-28255885 AATGCAGATAAGGCCGGGCATGG + Intergenic
1164578594 19:29420601-29420623 GGTGGAGAGGAGGCCGGGGGAGG - Intergenic
1164578623 19:29420748-29420770 GGTGGAGAGGAGGCCGGGGGAGG - Intergenic
1164578634 19:29420797-29420819 GGTGGAGAGGAGGCCGGGGGAGG - Intergenic
1165043118 19:33082946-33082968 AATAGAGATGAGGCCGGGCGTGG + Intronic
1165077239 19:33286696-33286718 AAGGCAGAGAAGGCCGGGTGCGG - Intergenic
1165309434 19:35021607-35021629 TAGGGACAGAAGGCCGGCTGGGG + Intronic
1165548786 19:36565410-36565432 AATGAAGAACAGGCCGGGCGCGG + Intronic
1165612072 19:37164126-37164148 TATAGGAAAAAGGCCGGGCGTGG + Intronic
1166040394 19:40198775-40198797 TCTAGAGACAAGGCCGGGCGCGG + Intronic
1166210282 19:41302507-41302529 CATAGACAGAAGGGCGGGCGCGG - Intronic
1166734440 19:45075976-45075998 GAAGGAGATAAGGCAGGGCGAGG + Intronic
1166874908 19:45891161-45891183 GGTGGAGACAAGGCCAGGCGAGG + Exonic
1167110483 19:47457709-47457731 TAGGGAGAGACGACGGGGCGGGG - Intronic
1167140164 19:47644789-47644811 TATGGAATGAAATCCGGGCGCGG - Intronic
1167143233 19:47666565-47666587 AAAGAAAAGAAGGCCGGGCGTGG - Intronic
1167214880 19:48157834-48157856 TATGGAGAGAAGGCTGGGCACGG - Intronic
1167256322 19:48431873-48431895 AAAGGAAAGCAGGCCGGGCGCGG - Intronic
1167261550 19:48461791-48461813 GATGAAGAGGAGGCCGGGCCCGG + Exonic
1167368728 19:49068188-49068210 AAGGCAGAAAAGGCCGGGCGCGG - Exonic
1167625872 19:50588810-50588832 TAGGGAAAGTAGGCCGGGCGCGG + Intergenic
1167827286 19:51985714-51985736 TAAGAAGTGAAGGCCGGGCGCGG + Intronic
1167859009 19:52268171-52268193 TAGGGATATAAGGCCGGGTGCGG + Intergenic
1167969813 19:53182075-53182097 TAAGTAATGAAGGCCGGGCGCGG + Intronic
925547553 2:5034400-5034422 AGTGAAGACAAGGCCGGGCGTGG - Intergenic
925784797 2:7421568-7421590 AATGGAGAGAAGGCAGGGTATGG - Intergenic
926361916 2:12096670-12096692 TTGGGAGAGAAGGAGGGGCGAGG + Intergenic
926878569 2:17514469-17514491 TAAGGACATAAGGCCTGGCGTGG + Intronic
927229520 2:20808369-20808391 TAACAAGACAAGGCCGGGCGCGG + Intronic
927327508 2:21822268-21822290 TAAGGCGGGAAGGCGGGGCGGGG + Intergenic
927478397 2:23431600-23431622 AAAGCAGTGAAGGCCGGGCGCGG + Intronic
927549941 2:23989541-23989563 TATAGAAATAAGGCCGGGTGTGG - Intronic
928074663 2:28253111-28253133 TATGGAGTGAAGGCTGAGTGCGG + Intronic
928621036 2:33088161-33088183 TATGGACAGTGAGCCGGGCGCGG + Intronic
928650377 2:33397810-33397832 GATGGAGAAGAGGCCAGGCGTGG - Intronic
928653968 2:33429989-33430011 AATGTAGAGAGGGCCGGGCATGG - Intergenic
928667708 2:33567277-33567299 TATGGAGTATAGGCCGGGTGCGG + Intergenic
928983793 2:37160926-37160948 TACAGAAAGAAGGCCGGGCGTGG + Intergenic
929032724 2:37663882-37663904 CAGGCAGAGGAGGCCGGGCGCGG + Intronic
929230737 2:39557241-39557263 TATGGAGAAAAGGCAGGGCATGG - Intergenic
929239026 2:39634750-39634772 AACAGAGCGAAGGCCGGGCGTGG + Intergenic
930139031 2:47933129-47933151 TATAGAAAGAAGGCCGGGCATGG + Intergenic
930420067 2:51140252-51140274 GAGAGAGAGAGGGCCGGGCGCGG + Intergenic
930482959 2:51972301-51972323 TGTGGAGATACGGCCGGGCGCGG - Intergenic
930789549 2:55310289-55310311 AGTGGAGATAAGGCAGGGCGTGG + Intronic
930864719 2:56111176-56111198 TATGGAAGGCAGGCCGGGCGTGG - Intergenic
931370564 2:61658684-61658706 TTAAGAGTGAAGGCCGGGCGCGG - Intergenic
931378783 2:61732641-61732663 TATCTAGAACAGGCCGGGCGCGG - Intergenic
931388268 2:61816638-61816660 TTTGTAGAGACGGCGGGGCGGGG + Intergenic
931437368 2:62260380-62260402 TTTTGAAATAAGGCCGGGCGCGG + Intergenic
931537168 2:63291841-63291863 AAAGAAAAGAAGGCCGGGCGCGG + Intronic
931606888 2:64061619-64061641 AAGGGACACAAGGCCGGGCGCGG - Intergenic
931757272 2:65385260-65385282 AGTGGAAAGCAGGCCGGGCGTGG - Intronic
932607262 2:73173730-73173752 TATGAAGATTCGGCCGGGCGCGG - Intergenic
933392027 2:81682411-81682433 ACTGGAGGAAAGGCCGGGCGCGG - Intergenic
933969054 2:87455373-87455395 TATGAAGAGAATGTCGGGAGAGG + Intergenic
934554372 2:95279583-95279605 TATGCAGAAGCGGCCGGGCGCGG - Intronic
934723179 2:96596265-96596287 AAAGGAGGGAAGGCCAGGCGAGG + Intronic
935202568 2:100870680-100870702 TAAGCAGAGAAGGCTGGGAGTGG - Intronic
935307073 2:101747406-101747428 TACGGACACAAGGCCGGGCATGG - Intronic
935717257 2:105950231-105950253 TATAGAAAGCAGGCCGGGCATGG + Intergenic
935988268 2:108695496-108695518 AAGCGTGAGAAGGCCGGGCGCGG - Intergenic
936324737 2:111495134-111495156 TATGAAGAGAATGTCGGGAGAGG - Intergenic
936697267 2:114965686-114965708 GATAAAGAGGAGGCCGGGCGCGG + Intronic
936704230 2:115052659-115052681 AATGGAAAACAGGCCGGGCGTGG + Intronic
937938883 2:127269709-127269731 TGTGAATAGAAGGCCAGGCGCGG - Intronic
938018727 2:127888489-127888511 TATGTAGTAATGGCCGGGCGCGG + Intergenic
938342047 2:130542054-130542076 GAGGGAGAGGAGGCCGGGCACGG + Intronic
938347785 2:130578657-130578679 GAGGGAGAGGAGGCCGGGCACGG - Intronic
938538259 2:132263772-132263794 TATCAAGAGAAGGCCAGGCACGG + Intergenic
938779061 2:134568232-134568254 AAAGGAAAGAAGGCAGGGCGTGG + Intronic
939145557 2:138410503-138410525 GATGGAGAGATGGCCAGGCACGG - Intergenic
939669736 2:144995449-144995471 TAAGGGGAAAAGGCCGGGTGTGG - Intergenic
940211300 2:151258850-151258872 TATGGAATGCAGGCCGGGCACGG + Intronic
940880913 2:158945863-158945885 AACAGAGAGAAGGCTGGGCGTGG + Intergenic
941240492 2:163029992-163030014 AAGGGAGATTAGGCCGGGCGTGG - Intergenic
942044181 2:172089912-172089934 TAAGGAGAGAATGCCTGGCGAGG + Intergenic
942481612 2:176394239-176394261 AATGGATTGACGGCCGGGCGTGG + Intergenic
942948942 2:181700831-181700853 AGTAGAAAGAAGGCCGGGCGCGG - Intergenic
943428402 2:187766031-187766053 AATGTAGACAAGGCTGGGCGGGG + Intergenic
944065826 2:195618027-195618049 AATAGAGACAAGGCCGGGCGAGG - Intronic
944144698 2:196494483-196494505 GATGGGGAGAAGGCAGGGAGAGG + Intronic
944809957 2:203318290-203318312 TAAAGAGAAAAGGCCGGGTGTGG + Intergenic
945330918 2:208538057-208538079 GAGAGAGAGGAGGCCGGGCGCGG + Intronic
945448301 2:209964496-209964518 TAACAAGATAAGGCCGGGCGCGG + Intronic
946238063 2:218337361-218337383 TAAGAATTGAAGGCCGGGCGCGG - Intronic
946259534 2:218475325-218475347 TATGTAAAGAAGGCTGGGCGAGG + Intronic
946725129 2:222654906-222654928 TATGGGGTGGGGGCCGGGCGCGG + Intronic
946746070 2:222847274-222847296 GATTGAGTGACGGCCGGGCGTGG + Intergenic
946909725 2:224447601-224447623 TAAAAAAAGAAGGCCGGGCGCGG - Intergenic
947085140 2:226442757-226442779 TATGGAGGGAAGGTTGGGGGAGG + Intergenic
947289259 2:228554044-228554066 TAAGGAGATCAGTCCGGGCGTGG + Intergenic
948389935 2:237604712-237604734 AATGGAGAAACGGCCGGGTGTGG + Intergenic
1169030339 20:2401945-2401967 TTAGGAGAGATGGCTGGGCGCGG + Intronic
1169479250 20:5962662-5962684 TAAGAAATGAAGGCCGGGCGCGG - Intronic
1170826195 20:19798139-19798161 TAAGTAGAATAGGCCGGGCGTGG - Intergenic
1171811603 20:29748769-29748791 TATGAAGAGAAGGCCAGGCATGG + Intergenic
1172294656 20:33800280-33800302 AATTGAGATAAGGCCGGGCGTGG + Intergenic
1172456940 20:35084007-35084029 TACAGAAAGCAGGCCGGGCGCGG + Intronic
1172961270 20:38801823-38801845 AGTGGAAACAAGGCCGGGCGCGG - Intergenic
1173163131 20:40667028-40667050 AAGAGAGTGAAGGCCGGGCGCGG + Intergenic
1173483237 20:43420029-43420051 TACGGAAAGAAGGCCAGGCATGG + Intergenic
1173806952 20:45932455-45932477 AATAGATAAAAGGCCGGGCGCGG + Intergenic
1174228844 20:49027404-49027426 AATGGAGAGCAGGCCAGGCAAGG + Intronic
1174805740 20:53603137-53603159 TATAGACAACAGGCCGGGCGCGG + Intronic
1175006325 20:55687301-55687323 TAAGAAGAGTAGGCCAGGCGTGG + Intergenic
1175148671 20:56915919-56915941 TAATAAGAGAAGGCAGGGCGGGG - Intergenic
1175259328 20:57664695-57664717 GAAGGAGAGAAGGCCCAGCGCGG + Intronic
1175893709 20:62326873-62326895 CATGGAGAGCAGGCCGGATGTGG - Exonic
1177679511 21:24347556-24347578 TATTGAGAAGAGGCTGGGCGTGG - Intergenic
1177910868 21:27030459-27030481 AAAGGGGAAAAGGCCGGGCGCGG + Intergenic
1178138569 21:29656071-29656093 TGAAGAGAGAAGGCCGGGTGCGG + Intronic
1178310024 21:31522159-31522181 TATTAAGAGCCGGCCGGGCGTGG - Intronic
1178463586 21:32825919-32825941 GAGGGAGAGGAGGCTGGGCGCGG + Intergenic
1178817782 21:35947066-35947088 TATACAGGGAAGGCTGGGCGTGG - Intronic
1178897687 21:36573009-36573031 ATTGGAGGGGAGGCCGGGCGTGG + Intronic
1178941659 21:36911776-36911798 TAAACAGAGAGGGCCGGGCGCGG + Intronic
1179045832 21:37844345-37844367 TATGCAAAGTAGGCCGGGCACGG - Intronic
1179450602 21:41465946-41465968 TAGGGAGAGCAGGCTGGGCAGGG + Exonic
1179572547 21:42286535-42286557 GATGGAGAGGAGACAGGGCGAGG + Intronic
1180100611 21:45582282-45582304 TCTGGAGAGTATGGCGGGCGTGG + Intergenic
1180313847 22:11260423-11260445 TATCAAGAGAAGGCCAGGCAAGG + Intergenic
1180341502 22:11623134-11623156 TATCAAGAGAAGGCCAGGCACGG - Intergenic
1180627569 22:17204324-17204346 TAAGAAGAGGAGGCCAGGCGTGG + Intronic
1181163407 22:20970891-20970913 AATGGAGAGAAGGCCAGGTGTGG - Intronic
1181952341 22:26563617-26563639 GAGGGAGGGAGGGCCGGGCGTGG - Intronic
1182421148 22:30249107-30249129 TCTGGAGGGAAGGCTGGGCAGGG + Intergenic
1182536502 22:31007756-31007778 TAAGAAGAGGAGGCCGGGTGTGG + Intergenic
1183061517 22:35339038-35339060 ACTGGAGACCAGGCCGGGCGTGG + Intronic
1183120251 22:35724899-35724921 TGTGGATACAAGGCCGGGCACGG - Intronic
1183149351 22:36025972-36025994 AATGTATAGAAGGCCGGGTGTGG + Intronic
1183217581 22:36490864-36490886 TATGAAGAAACGGCCGGGCGTGG + Intronic
1183282170 22:36937767-36937789 AGTGGAGAGAAGGCCGAGCCAGG + Exonic
1184047774 22:41982216-41982238 CTTTGAGAGAAGGCCGGGTGTGG + Intronic
1184095840 22:42315821-42315843 TATAAAGACAAGGCTGGGCGTGG + Intronic
1184136600 22:42553728-42553750 TGTGGCGGGAAGGCCGGGCCTGG + Intronic
1184182983 22:42843522-42843544 AATGGAGACAAGGCCGGGCATGG - Intronic
1184299729 22:43550379-43550401 AATGTTCAGAAGGCCGGGCGCGG + Intronic
1184380459 22:44142085-44142107 GATGAGGAGAGGGCCGGGCGCGG + Intronic
1184492378 22:44817175-44817197 TAAGAAAAGAAGGCCGGGCATGG - Intronic
1184525132 22:45018165-45018187 TAAGAACAGAGGGCCGGGCGTGG + Intergenic
1184574387 22:45350564-45350586 TCAGGAGACAGGGCCGGGCGCGG - Intronic
1185042549 22:48512628-48512650 AAGAGAGAGACGGCCGGGCGCGG + Intronic
1185062598 22:48614878-48614900 CCTGGAGAGAAGGCCGGGCATGG + Intronic
1185156142 22:49194582-49194604 AATGGAGACAGGGCCGGGCGCGG + Intergenic
1185244202 22:49764598-49764620 TAAGCAGAGATGGCCGGGCGCGG + Intergenic
1185374104 22:50474448-50474470 CAGGGAGAGAAGGCTGGGCCCGG - Intronic
949105506 3:197164-197186 TATGGAAAGGAAGCGGGGCGCGG + Intronic
949139939 3:620032-620054 CATGGAGATATGGCCGGGCGCGG + Intergenic
950119657 3:10473339-10473361 TATGAAGAGCAGGCCAGGTGTGG + Intronic
950572334 3:13809179-13809201 TATGGAGAGAAGGGCCCACGTGG + Intergenic
951810439 3:26693038-26693060 GATCAAGAGCAGGCCGGGCGCGG + Intronic
952051284 3:29387610-29387632 AATGTATAGATGGCCGGGCGCGG + Intronic
952868433 3:37874438-37874460 TACAGACACAAGGCCGGGCGCGG + Intronic
953963566 3:47284625-47284647 TAAGAAGAGCAGGCTGGGCGCGG - Intronic
955073454 3:55591115-55591137 TATGGAGATATGGCTGGGCACGG - Intronic
956606502 3:71078120-71078142 TATACAGAGGAGGCCGGGCGGGG - Intronic
956688271 3:71852665-71852687 AATGGGGTTAAGGCCGGGCGCGG - Intergenic
956863024 3:73342892-73342914 TATGGAAATAAGGCCGGGCGCGG - Intergenic
956922130 3:73940864-73940886 CACAGGGAGAAGGCCGGGCGCGG - Intergenic
957401842 3:79725514-79725536 TAAGAAGAGAGGGCCGGGCGCGG - Intronic
957842075 3:85684971-85684993 AATGGAGAATCGGCCGGGCGCGG + Intronic
958542845 3:95501529-95501551 TACAGATAGAGGGCCGGGCGTGG + Intergenic
959057427 3:101582028-101582050 TAGAAAGAGTAGGCCGGGCGTGG - Intronic
959324123 3:104914306-104914328 TAAGAAAAGAAGGCCGGGCGTGG + Intergenic
959506922 3:107166490-107166512 TATGAACCAAAGGCCGGGCGTGG + Intergenic
960076478 3:113491328-113491350 TATCTATAGCAGGCCGGGCGTGG + Intronic
960078923 3:113519817-113519839 TATTGAGTGTAGGCCGGGCTCGG + Intergenic
960217866 3:115064741-115064763 TTCAGAGAGAAGGCCGGGCACGG - Intronic
960244721 3:115387474-115387496 AAGGGAGAGTTGGCCGGGCGTGG - Intergenic
960328886 3:116332128-116332150 AATAGAGTGAAGGCCGGGTGTGG - Intronic
961139480 3:124543589-124543611 TATGTCCACAAGGCCGGGCGCGG - Intronic
961438333 3:126934837-126934859 TGAGGTGGGAAGGCCGGGCGTGG - Intronic
961732299 3:128974829-128974851 AAAGAAGAGAAGGCCAGGCGTGG + Intronic
962115826 3:132506340-132506362 AATGTACAGAAGGCCGGGCGCGG - Intronic
962505532 3:136043167-136043189 TATAGGGAAATGGCCGGGCGTGG + Intronic
962743540 3:138381061-138381083 AACGGAGAGAAGGCCGGGCGTGG - Intronic
962771277 3:138612389-138612411 TAGCCAGACAAGGCCGGGCGCGG - Intronic
962792522 3:138824502-138824524 TAAGGAGATATGGCCGGGCGCGG + Intronic
963324077 3:143842088-143842110 TACAGAGTGCAGGCCGGGCGCGG + Intronic
963431802 3:145216488-145216510 AATGGAGTCAGGGCCGGGCGTGG - Intergenic
963802580 3:149691724-149691746 TTTAAAAAGAAGGCCGGGCGCGG + Intronic
964044545 3:152307277-152307299 TATGAATAGTAGGCTGGGCGCGG - Intronic
964096731 3:152940507-152940529 TGAGCAGAGAAGGCCGGGCATGG + Intergenic
964616999 3:158676988-158677010 AATGGAGGTGAGGCCGGGCGTGG - Intronic
965100251 3:164288942-164288964 TATAGTAAGAAGGCCGGGCGCGG - Intergenic
966133524 3:176671866-176671888 AGGGGAGAGTAGGCCGGGCGCGG + Intergenic
966196087 3:177314926-177314948 CTGGGAGAAAAGGCCGGGCGTGG - Intergenic
966703506 3:182883663-182883685 AATGCAGACTAGGCCGGGCGCGG + Intronic
966951712 3:184825609-184825631 TCTGGAAAGTAGGCCGGGCGTGG + Intronic
966997700 3:185299854-185299876 GAGAGAGAGAGGGCCGGGCGCGG - Intronic
966997765 3:185300462-185300484 TAAGGAAATAGGGCCGGGCGTGG - Intronic
967092337 3:186145723-186145745 AATGGAGACTTGGCCGGGCGTGG + Intronic
967336758 3:188352643-188352665 CATAGAGAGAAGGCTGGGAGAGG + Intronic
967347583 3:188475610-188475632 TATGAAAAGCAGGCCGGGCGTGG + Intronic
967563943 3:190952008-190952030 TAAAGAGTGTAGGCCGGGCGCGG + Intergenic
967594670 3:191315301-191315323 TTTGTAGAGTAGGCCGGGCGTGG - Intronic
968178853 3:196575163-196575185 GAGGAAGAGAGGGCCGGGCGTGG + Intronic
968436106 4:590376-590398 AGTGGAGAGAGGGCCGGGCATGG - Intergenic
968475357 4:803673-803695 GAAAGAAAGAAGGCCGGGCGCGG - Intronic
968551561 4:1226177-1226199 TCTGGGGACAAGGCCGGGAGCGG - Intronic
969140814 4:5070025-5070047 CATGGAGAGAAGGCAGGCAGGGG + Intronic
969185091 4:5468770-5468792 TATCTAGAGGAGGCCGGGCGCGG + Intronic
969251640 4:5972291-5972313 AATTGAAAGCAGGCCGGGCGCGG - Intronic
969522952 4:7689370-7689392 TTGGGAGAGAAGGCTGGGCCAGG - Intronic
970067525 4:12116062-12116084 TTTGGAGAGATGGCTGGGTGTGG + Intergenic
970150069 4:13080454-13080476 CATGGAGAAAAGGCCATGCGAGG - Intergenic
970203172 4:13629759-13629781 TATGCAGTCAAGGCTGGGCGTGG + Intergenic
970349880 4:15191806-15191828 TATGCATAGGAGGCCGGGCGCGG + Intergenic
971715135 4:30166356-30166378 TACTGAGAGCAGGCCGGGCGTGG + Intergenic
972306777 4:37838169-37838191 AACAGAGAAAAGGCCGGGCGTGG - Intronic
972417811 4:38859854-38859876 AATGGTGAAGAGGCCGGGCGGGG - Intergenic
972464638 4:39343311-39343333 TAGGGAGATTAGGCCAGGCGTGG - Intronic
972879766 4:43409047-43409069 AATGCAGAGGAGGCCGGGAGTGG + Intergenic
973313353 4:48732983-48733005 TAGTGAGAAAAGGCCGGGTGTGG + Intronic
973761195 4:54117267-54117289 AATGGACTCAAGGCCGGGCGCGG - Intronic
973823468 4:54683344-54683366 TATGCAGTTATGGCCGGGCGCGG + Intronic
973830683 4:54756049-54756071 AAAGGGGAGGAGGCCGGGCGCGG - Intergenic
974127793 4:57717189-57717211 GAACTAGAGAAGGCCGGGCGCGG + Intergenic
976235207 4:82889935-82889957 AAAGGAGAGTAGGCTGGGCGTGG + Intronic
977241698 4:94578118-94578140 TAAGAAGAGTTGGCCGGGCGCGG - Intronic
977310124 4:95375785-95375807 TATACAGAATAGGCCGGGCGTGG + Intronic
978780560 4:112548822-112548844 AATGTAAAGATGGCCGGGCGCGG + Intronic
979353598 4:119675248-119675270 TAGAGAGAGAGGGCCGGGCACGG - Intergenic
979480788 4:121214530-121214552 TATGGAGAGGTGGCCGGGTGAGG + Intronic
979486491 4:121276541-121276563 TATGGAGAGAAGGGAGGGTATGG - Intergenic
979595213 4:122527257-122527279 TATAGATAGAAGGCCGGGCACGG + Intergenic
979783910 4:124691200-124691222 AAAGGAGAACAGGCCGGGCGTGG + Intronic
980468678 4:133220746-133220768 AAATGACAGAAGGCCGGGCGCGG - Intergenic
980932181 4:139192518-139192540 AAGGGAGAGTAGGCCGGGCGCGG - Intergenic
980933342 4:139202696-139202718 TAGTGAAAGGAGGCCGGGCGAGG + Intergenic
980938644 4:139250623-139250645 TATGAAGCGAGGGCTGGGCGTGG - Intergenic
980981235 4:139656189-139656211 AATGCACATAAGGCCGGGCGTGG - Intergenic
981727099 4:147860150-147860172 TAACAGGAGAAGGCCGGGCGTGG + Intronic
982252493 4:153421333-153421355 TTGTGAGAGAAGGCCGGGCGCGG + Intergenic
983335805 4:166390664-166390686 TTTGGAAAACAGGCCGGGCGCGG + Intergenic
983449305 4:167890847-167890869 TAGGGAGGGAAGGCCAGGCGCGG + Intergenic
984049516 4:174846301-174846323 AATGTAAAGGAGGCCGGGCGCGG - Intronic
984102536 4:175502535-175502557 TTATGAGAGGAGGCCGGGCGCGG - Intergenic
984150996 4:176130452-176130474 TACTGAGAAATGGCCGGGCGCGG + Intronic
984402190 4:179280844-179280866 TTTAGTGTGAAGGCCGGGCGCGG + Intergenic
985026801 4:185746606-185746628 TAACCAGATAAGGCCGGGCGCGG - Intronic
985898256 5:2763543-2763565 TCTGGAGAGGAGGCCAGGAGAGG - Intergenic
986012907 5:3732832-3732854 GCTGCAGAGAGGGCCGGGCGCGG + Intergenic
986565473 5:9109328-9109350 ATTGAAGAGAAGGCTGGGCGCGG - Intronic
986607860 5:9540297-9540319 TATGGAGAGAAGGCCGGGCGCGG + Intronic
986956430 5:13156285-13156307 TACAGAGATAAGGCCAGGCGTGG + Intergenic
987619609 5:20324243-20324265 TGTAGGGGGAAGGCCGGGCGCGG + Intronic
987875182 5:23672573-23672595 TTTGGAAAGCAGGCCGGGCGCGG + Intergenic
988000658 5:25343433-25343455 GAAAGAGAGAAGGCCGGGCGCGG - Intergenic
988520672 5:31942910-31942932 TACAGAGACAAGGCCGGGCACGG + Intronic
988536333 5:32072438-32072460 GCTGGAGACCAGGCCGGGCGCGG + Intronic
989042264 5:37241161-37241183 AATGTAGAGAAGGCCAGGCATGG + Intronic
989279231 5:39622073-39622095 CATGGGGAGAAGGCCGAGGGAGG - Intergenic
989802647 5:45563157-45563179 TATATAGTGAAGGCCGGGTGCGG + Intronic
989962248 5:50430177-50430199 TATGGACAGGAAGCCAGGCGGGG + Intronic
990467550 5:56084162-56084184 TAGGGAGATGAGGCTGGGCGCGG - Intergenic
990581931 5:57173970-57173992 GAGGGAGGGAAGGCGGGGCGAGG - Intronic
990743484 5:58935806-58935828 TAGGGGAAGATGGCCGGGCGCGG - Intergenic
990963472 5:61419110-61419132 TATAAAGAGGAGGCCGGGCGTGG - Intronic
991947297 5:71911644-71911666 TAAGAAAACAAGGCCGGGCGCGG + Intergenic
992223310 5:74593709-74593731 TATTGAGAAACGGCCGGGCACGG - Intergenic
992251494 5:74880332-74880354 AATGGAAATAAGGCCGGGCTCGG - Intergenic
992953737 5:81886992-81887014 TAAGAAAAGCAGGCCGGGCGCGG - Intergenic
993204779 5:84864508-84864530 AAGAGAGAGAGGGCCGGGCGTGG - Intergenic
994268593 5:97747763-97747785 AATGAATTGAAGGCCGGGCGGGG - Intergenic
994374007 5:98997591-98997613 AATGGAGACTTGGCCGGGCGTGG + Intergenic
994864894 5:105255246-105255268 GAAAGAAAGAAGGCCGGGCGCGG + Intergenic
995135515 5:108675772-108675794 AATGGAGACCTGGCCGGGCGCGG - Intergenic
995438084 5:112160198-112160220 TGTGAAAAGAACGCCGGGCGCGG - Intronic
995506739 5:112868688-112868710 AATGTAAAGAAGGCCGGGCACGG - Exonic
995576890 5:113546028-113546050 AATGGAGATCAGGCCGGGCGCGG - Intronic
996555737 5:124777339-124777361 TATCTAGAGAAGGCCGGGTGTGG + Intergenic
996943861 5:129043288-129043310 GAGGGGGAGAGGGCCGGGCGCGG - Intergenic
996969120 5:129342336-129342358 AATAGACAGTAGGCCGGGCGTGG + Intergenic
997934440 5:138098104-138098126 AAAAGAGAGAAGGCTGGGCGCGG + Intergenic
997938435 5:138134991-138135013 TATTTAGTGACGGCCGGGCGCGG - Intronic
998510251 5:142707117-142707139 ACTGGAGAGATGGCCGGGTGTGG - Intergenic
999415992 5:151396389-151396411 TAATAAGAGAAGGCCGGGCATGG - Intergenic
999767857 5:154755035-154755057 ATAGGAGAGAAGGCTGGGCGAGG - Intronic
999907521 5:156158542-156158564 ACTGGAGAGAAGGCCGTGAGTGG - Intronic
999988977 5:157032226-157032248 TATGAAAAAATGGCCGGGCGCGG + Intronic
1000927426 5:167210751-167210773 AATGCAATGAAGGCCGGGCGCGG - Intergenic
1001050022 5:168406649-168406671 TAGGGAGAGTCGGCCGGGCGCGG + Intronic
1001305055 5:170566381-170566403 TACGGATAGTTGGCCGGGCGCGG - Intronic
1001587842 5:172845285-172845307 GCTGGAGAGGAGGCCGGGCCTGG + Intronic
1001819644 5:174699905-174699927 GTTGGAGAGAGGGCCAGGCGCGG - Intergenic
1002275489 5:178101860-178101882 TACAGAGAAAAGGCCGGGCGCGG - Intergenic
1002282102 5:178137125-178137147 GATGGAGAGCAGGCCAGGTGAGG + Intronic
1002719620 5:181250243-181250265 AATGCAGGGATGGCCGGGCGCGG + Intergenic
1002747049 6:66883-66905 AACGGAAAGTAGGCCGGGCGTGG + Intergenic
1002918886 6:1551767-1551789 GATGTAGAGATGGCCGGGCGTGG + Intergenic
1003086913 6:3068032-3068054 TATGCACATCAGGCCGGGCGCGG - Intronic
1003250425 6:4424857-4424879 AAGGGAAAGAAGGCCGGGCACGG + Intergenic
1004105232 6:12661217-12661239 AATGGAGAAGAGGCCGGGCGCGG - Intergenic
1004228045 6:13805280-13805302 TATGCTGATAAGGCCAGGCGAGG - Intronic
1004440925 6:15652911-15652933 TATGAAAATAAGGCCTGGCGTGG - Intronic
1004643299 6:17536111-17536133 AACAGAGAGAAGGCTGGGCGCGG - Intronic
1005009940 6:21326130-21326152 TAAAGAAAGAAGGCCAGGCGCGG - Intergenic
1005022520 6:21431842-21431864 TAGGAAGAGTAGGCTGGGCGTGG + Intergenic
1005045556 6:21638882-21638904 TATGGAGATATTGCCAGGCGTGG - Intergenic
1005572311 6:27157255-27157277 TAAAGAGAAGAGGCCGGGCGCGG + Intergenic
1005601623 6:27431984-27432006 TATTGAGAGAAAGCAGGGAGAGG + Intergenic
1005619855 6:27609864-27609886 TGTGGAAAGTAGGCCGGACGCGG + Intergenic
1005620358 6:27614390-27614412 GATGGAGCCTAGGCCGGGCGCGG + Intergenic
1005642795 6:27812860-27812882 TATGGACAACAGGCCGGGCGCGG + Intergenic
1005959289 6:30684637-30684659 TATGGGGTGAAGGCAGGGCCAGG - Exonic
1006283617 6:33076624-33076646 TAAGGAGAGAAGGGAGGGAGGGG + Intronic
1006631576 6:35433997-35434019 TATGAAAAGATGGCCGGGCGTGG + Intergenic
1006753177 6:36392376-36392398 AATGGAGAGAAGACTGGGCATGG + Intronic
1006825754 6:36934601-36934623 TATAAAATGAAGGCCGGGCGGGG - Intergenic
1006842639 6:37039654-37039676 GATGCTGAGCAGGCCGGGCGTGG + Intergenic
1008881964 6:56389070-56389092 TATGCAAAGGAGGCTGGGCGTGG + Intronic
1009947509 6:70356760-70356782 TAGGGATATAAGGCCGGGCGTGG + Intergenic
1010001798 6:70956302-70956324 TAGGGAGAGAAGTAGGGGCGCGG + Exonic
1010159690 6:72838658-72838680 TATGGAGCTGAGGCCGGGCGCGG + Intronic
1010221186 6:73450696-73450718 TGGGGACAGACGGCCGGGCGCGG + Intronic
1010376556 6:75177144-75177166 TATTGACACAAGGCCGGGCGTGG + Intronic
1011144728 6:84200986-84201008 TATGCAATGCAGGCCGGGCGCGG + Intronic
1011278556 6:85654191-85654213 TACTGACAAAAGGCCGGGCGCGG + Intergenic
1012503422 6:99916252-99916274 TGAGGAGAGGAGGCCCGGCGTGG + Intergenic
1012852496 6:104464184-104464206 TAAGAAAACAAGGCCGGGCGCGG + Intergenic
1012869005 6:104651961-104651983 TTCAGAGAGAAGGCCAGGCGTGG + Intergenic
1012884061 6:104824781-104824803 AATGCAAAGAAGGCCGGGCACGG + Intronic
1013062039 6:106644160-106644182 AAAGAAAAGAAGGCCGGGCGTGG - Intronic
1013115970 6:107103999-107104021 AAAAAAGAGAAGGCCGGGCGTGG + Intronic
1013238601 6:108222045-108222067 AATGTAAAGAAGGCCGGGCATGG - Intronic
1013390800 6:109684582-109684604 TAGGCAAAGGAGGCCGGGCGCGG + Intronic
1013953263 6:115810711-115810733 AAGTGAGTGAAGGCCGGGCGTGG + Intergenic
1013969581 6:116000947-116000969 TATGGAGCTTGGGCCGGGCGTGG + Intronic
1014006919 6:116429656-116429678 TATGAGGAGTTGGCCGGGCGCGG + Intronic
1014436437 6:121426008-121426030 TAGTGAGAACAGGCCGGGCGCGG + Intergenic
1014697218 6:124638603-124638625 TAAGCAAAGAGGGCCGGGCGCGG + Intronic
1014902119 6:126979528-126979550 GAAGGTCAGAAGGCCGGGCGCGG - Intergenic
1015067812 6:129052436-129052458 GACAGAGAAAAGGCCGGGCGCGG - Intronic
1015749825 6:136549469-136549491 TATGGAGAGATGGGCGGGGTTGG + Intronic
1015930194 6:138351627-138351649 CATAGAAAGATGGCCGGGCGTGG + Intergenic
1015966115 6:138696604-138696626 TATGGACAGAAGTGCGGGCAAGG + Intergenic
1016069572 6:139724024-139724046 TTTGTAAAGACGGCCGGGCGCGG + Intergenic
1016472284 6:144387427-144387449 AATGGGAAGAAGGCCGGGCATGG - Intronic
1016959240 6:149655660-149655682 TATGTAGGGAAGGCTGGGTGCGG - Intergenic
1017018088 6:150117333-150117355 TTGGGGGCGAAGGCCGGGCGAGG - Intergenic
1017097832 6:150820572-150820594 AATGCAAATAAGGCCGGGCGCGG + Intronic
1017493242 6:154962372-154962394 GAAAGAAAGAAGGCCGGGCGCGG + Intronic
1017575368 6:155796529-155796551 AATTTGGAGAAGGCCGGGCGCGG + Intergenic
1018409207 6:163524755-163524777 AATAAACAGAAGGCCGGGCGTGG - Intronic
1019074843 6:169379006-169379028 TATGGAGAGAAGGCAGACAGGGG - Intergenic
1019201416 6:170319374-170319396 TACAGGGAGAAGGCCGGGCGTGG + Intronic
1019229832 6:170550844-170550866 AAAGGAGAGGAGGCCGGGCACGG + Intronic
1019546839 7:1581914-1581936 TCTGGAGACAAGGCAGGGAGCGG - Intergenic
1019683103 7:2363969-2363991 TTTGCAGAATAGGCCGGGCGCGG + Intronic
1019930692 7:4221058-4221080 CAGGGAGGCAAGGCCGGGCGTGG - Intronic
1020036391 7:4965833-4965855 AAGGGAGTCAAGGCCGGGCGGGG - Intergenic
1020089243 7:5329010-5329032 TATTGATAGAAGGCCAGGCGTGG + Intronic
1020247568 7:6441705-6441727 TATGTATTGAAGGCCAGGCGCGG - Intronic
1020801097 7:12733204-12733226 TAGGGAAAATAGGCCGGGCGCGG - Intergenic
1021045927 7:15923438-15923460 AATGGAAAGACGGCTGGGCGTGG + Intergenic
1022021950 7:26408518-26408540 TATAGAGAAGAGGCCGGGTGCGG + Intergenic
1022761862 7:33364236-33364258 AATATAGTGAAGGCCGGGCGCGG - Intronic
1023408971 7:39868984-39869006 TATGTAGAATAGGCTGGGCGCGG + Intergenic
1023429946 7:40080276-40080298 TATTAAGAAAAGGCTGGGCGTGG - Intronic
1023861085 7:44218053-44218075 TATGGAGATAAGGCGGGCTGGGG - Exonic
1023861569 7:44220296-44220318 TGTGGACAGCAGGCGGGGCGGGG + Intronic
1024369590 7:48565571-48565593 AAAGAAGATAAGGCCGGGCGTGG + Intronic
1024539286 7:50463056-50463078 AAGGAAGAGAAGGCCGGGTGCGG - Intronic
1024666107 7:51548762-51548784 TATGTAGATAAGGCCGGGCATGG + Intergenic
1024994099 7:55258091-55258113 TATAGAAAGCCGGCCGGGCGCGG - Intergenic
1026034420 7:66820780-66820802 TACAAAGAGAGGGCCGGGCGTGG - Intergenic
1026439437 7:70431125-70431147 AATGGCGACACGGCCGGGCGCGG - Intronic
1026456616 7:70578118-70578140 TATGGACAAAAGGCCAGGTGCGG - Intronic
1026769197 7:73183515-73183537 AATGCACTGAAGGCCGGGCGCGG + Intergenic
1026988234 7:74568356-74568378 GAAGGAGAAAGGGCCGGGCGTGG + Intronic
1027010066 7:74736900-74736922 AATGCACTGAAGGCCGGGCGCGG + Intronic
1027077975 7:75209137-75209159 AATGCACTGAAGGCCGGGCGCGG - Intergenic
1027209593 7:76134733-76134755 AATGAAAAGACGGCCGGGCGCGG + Intergenic
1027229900 7:76266156-76266178 TATATAAATAAGGCCGGGCGCGG - Intronic
1027427537 7:78076554-78076576 TAATGAAATAAGGCCGGGCGCGG + Intronic
1028246610 7:88487005-88487027 AAGGGTGAGAGGGCCGGGCGTGG + Intergenic
1028334803 7:89638555-89638577 AATGTAAAGTAGGCCGGGCGCGG - Intergenic
1028904725 7:96140246-96140268 AATGGAAATCAGGCCGGGCGCGG - Intronic
1028959333 7:96731712-96731734 CATGAAAAGCAGGCCGGGCGCGG + Intergenic
1029125152 7:98290483-98290505 CCTTGAGAGATGGCCGGGCGCGG - Intronic
1029212141 7:98917829-98917851 TATGTAAAGAAGGCCGGGCACGG + Intronic
1029455901 7:100672283-100672305 AATGGGGAGAAGGCTGGGCGCGG + Intergenic
1029633823 7:101770489-101770511 AAGGAAGAAAAGGCCGGGCGCGG - Intergenic
1029681268 7:102112529-102112551 AATAGAGAGAGGGCTGGGCGCGG - Intronic
1029764807 7:102619580-102619602 TAAAGAAATAAGGCCGGGCGTGG + Intronic
1030317054 7:108126856-108126878 AAAGGAAAGAAGGCCGGGCGCGG - Intronic
1030351236 7:108490491-108490513 TAGGGTAAGAAGGCTGGGCGCGG + Intronic
1031028858 7:116713103-116713125 TAAGGAAAAGAGGCCGGGCGCGG + Intronic
1031681189 7:124676465-124676487 TAGGGAGAAAAGGCCTGGCGCGG - Intergenic
1032084494 7:128876944-128876966 TATGGAGAGAATGCCCTGCCTGG - Exonic
1032393755 7:131574361-131574383 TATGATGAGAAGGTCGGGTGCGG - Intergenic
1032727484 7:134604411-134604433 GAGAGAGAGAAGGCCGGGCACGG + Intergenic
1033173469 7:139104421-139104443 TAAGAAGTCAAGGCCGGGCGCGG + Intronic
1033601753 7:142893674-142893696 CATGTACAGACGGCCGGGCGCGG + Intergenic
1033720776 7:144057102-144057124 TAAGAAGAGTTGGCCGGGCGCGG - Intergenic
1034168770 7:149046435-149046457 TATGGCCAGGAGGCCGGGCACGG - Intergenic
1034624720 7:152483891-152483913 TAGAGACATAAGGCCGGGCGTGG - Intergenic
1034647661 7:152662861-152662883 AATGCAAATAAGGCCGGGCGCGG - Intronic
1034864266 7:154627486-154627508 AAAGGAAAAAAGGCCGGGCGTGG - Intronic
1035190448 7:157163093-157163115 TACCCAGAGATGGCCGGGCGCGG + Intronic
1036061352 8:5324974-5324996 TAGGCAGAGCAGGCCGGGCGCGG + Intergenic
1036141687 8:6215042-6215064 TAAGGACTGCAGGCCGGGCGCGG + Intergenic
1036439886 8:8772867-8772889 TATGGAGAGGAGGAGGCGCGGGG - Intergenic
1036620937 8:10424360-10424382 AATGGGGAGAAGGCCCGGGGTGG + Intronic
1036620967 8:10424448-10424470 AATGGGGAGAAGGCCCGGGGTGG + Intronic
1036980317 8:13462694-13462716 TAAGAATAGTAGGCCGGGCGCGG - Intronic
1037168405 8:15859082-15859104 GAGTGAGAGTAGGCCGGGCGCGG - Intergenic
1037578094 8:20226705-20226727 TATCCAGAACAGGCCGGGCGCGG - Intronic
1037818758 8:22125504-22125526 TCTGGAGAGAGGGCAGGGGGAGG + Exonic
1037852405 8:22342976-22342998 TAGGTAGATAAGGCCGGGTGTGG + Intronic
1037883196 8:22582866-22582888 TAAGGAGACTGGGCCGGGCGCGG - Intronic
1038749367 8:30281688-30281710 TTTGAAAAGCAGGCCGGGCGCGG + Intergenic
1039599614 8:38824082-38824104 TATGGAGAGATGGCTGGGGGAGG - Intronic
1040417937 8:47212471-47212493 TATTGAGAGACAGCCGGGTGTGG - Intergenic
1041037587 8:53810449-53810471 TGTGGAAAGAAGGCCTGGCGTGG + Intronic
1041609764 8:59831343-59831365 TAATCAGAGATGGCCGGGCGTGG - Intergenic
1042289944 8:67159810-67159832 AAGAGAGAGAAGGCCGGGCGTGG - Intronic
1042897609 8:73688002-73688024 TAAAGATAGTAGGCCGGGCGCGG - Intronic
1043609835 8:82048806-82048828 TAAGCAAAAAAGGCCGGGCGCGG - Intergenic
1043675501 8:82947887-82947909 TAAGGACAGAAGGCTGGGCGTGG + Intergenic
1043884753 8:85586191-85586213 TATCTATAAAAGGCCGGGCGCGG - Intergenic
1044321678 8:90808933-90808955 TAGGATGAAAAGGCCGGGCGCGG - Intronic
1044447782 8:92298625-92298647 TATTGAGAGTTGGCTGGGCGTGG - Intergenic
1044866585 8:96576707-96576729 TAAAGAGAATAGGCCGGGCGCGG - Intronic
1045265845 8:100618054-100618076 AATGGTGTGGAGGCCGGGCGTGG - Intronic
1045446342 8:102268492-102268514 TAGGAAGATAAGGCCGGGTGCGG - Intronic
1045526410 8:102944363-102944385 AATGGAGAACAGGCCGGGTGTGG + Intronic
1046009221 8:108526154-108526176 TACAATGAGAAGGCCGGGCGCGG + Intergenic
1046229280 8:111332241-111332263 TAAGGACAGGAGGCTGGGCGTGG - Intergenic
1046663150 8:116970802-116970824 TATGAAAATAAGGCCGGGGGTGG + Intronic
1046900273 8:119516315-119516337 TATGGCCAGTAGGCCGGGCATGG + Intergenic
1047033486 8:120910125-120910147 TATTAAGACAAGGCCGGGCATGG + Intergenic
1047268429 8:123330650-123330672 TATGAAGATAGGGCCAGGCGCGG - Intronic
1047428315 8:124766925-124766947 AAAGCAGACAAGGCCGGGCGCGG + Intergenic
1047998011 8:130355167-130355189 TATGGTAAGAAGGCTGGGCGTGG - Intronic
1048083784 8:131156339-131156361 AAAGAAGGGAAGGCCGGGCGCGG - Intergenic
1048547228 8:135398484-135398506 GATGGAGAGTAGGCTGGGCCTGG - Intergenic
1049120000 8:140727903-140727925 TAGAGAAAGACGGCCGGGCGCGG + Intronic
1049578735 8:143401289-143401311 TGTGGAGGGAAGGCCGGGGAGGG - Intergenic
1049722920 8:144128690-144128712 TCTGTAGTGATGGCCGGGCGCGG - Intergenic
1050600208 9:7242924-7242946 AGGGAAGAGAAGGCCGGGCGGGG - Intergenic
1050661678 9:7890153-7890175 AATGCAAAGAAGGCCAGGCGCGG + Intergenic
1050756339 9:9008514-9008536 AATGAAGGGGAGGCCGGGCGCGG - Intronic
1053191065 9:36069247-36069269 TATGAAGAGCAGGCCGGGTGCGG + Intronic
1054090653 9:60843836-60843858 AATGGAGTTCAGGCCGGGCGCGG - Intergenic
1054112064 9:61119393-61119415 AATGGAGTTCAGGCCGGGCGCGG - Intergenic
1054720462 9:68598429-68598451 TGTGGAAAGAAGGCCAGGCACGG - Intergenic
1054963640 9:70997483-70997505 TATTAAGATAGGGCCGGGCGCGG - Intronic
1055111155 9:72561021-72561043 AAGAGAGAAAAGGCCGGGCGCGG + Intronic
1055456292 9:76475065-76475087 TGTTCAGAGAAAGCCGGGCGTGG - Intronic
1055946494 9:81695795-81695817 AATAAAAAGAAGGCCGGGCGCGG - Intergenic
1055961177 9:81821871-81821893 TATAAAGAGATGGCCGGGCGCGG + Intergenic
1056394923 9:86173062-86173084 AATGGAAAGACGGCCGGGCGCGG - Intergenic
1056814982 9:89794635-89794657 TGTGGAAACAAGGCCGGGCATGG - Intergenic
1056984092 9:91345541-91345563 TACCCAGAGAAGGCCAGGCGTGG + Intronic
1057619829 9:96624948-96624970 TAAGAAGTGAAGTCCGGGCGTGG - Intergenic
1058157247 9:101529443-101529465 AGCTGAGAGAAGGCCGGGCGCGG - Intronic
1058417461 9:104803485-104803507 GATGGAGAGAAGGCTGGAAGAGG - Intronic
1058482657 9:105412891-105412913 AATGCAGAGTAGGCAGGGCGTGG - Intronic
1058708218 9:107655233-107655255 TATATAGAGAGGGCTGGGCGTGG + Intergenic
1058803941 9:108571880-108571902 AATGGAGAGGAGGCCAGGAGCGG + Intergenic
1059475108 9:114540312-114540334 TATGCAAAGGAGGCCGGGTGCGG + Intergenic
1059535608 9:115077478-115077500 TATGATGAGGAGGCCGGGCGTGG - Intronic
1060109220 9:120894605-120894627 TGCCAAGAGAAGGCCGGGCGCGG + Intronic
1060161807 9:121370858-121370880 AAAGGAGAGGAGGCCGGGCGCGG + Intergenic
1060642178 9:125248332-125248354 TATGAAGAGCTGGCCGGGCGCGG + Intergenic
1061098847 9:128476927-128476949 TTTAAAGATAAGGCCGGGCGCGG - Intronic
1061332066 9:129901114-129901136 AATGACGAGAAGGCCGGGCGCGG + Intronic
1061946375 9:133910518-133910540 CAGGGACAGAAGGCTGGGCGCGG + Intronic
1062347173 9:136120192-136120214 TATTGAGATAAGGCTGGGCGTGG + Intergenic
1185452031 X:287031-287053 TAAAGGGGGAAGGCCGGGCGTGG + Intronic
1185460306 X:330207-330229 TATTAAAAAAAGGCCGGGCGCGG + Intergenic
1185509068 X:649326-649348 AAGAGAGAGGAGGCCGGGCGCGG - Intronic
1185689753 X:2144679-2144701 TAAGAACAGGAGGCCGGGCGTGG + Intergenic
1185704575 X:2257242-2257264 TATGGTGAGTGGGCCGGGCATGG - Intronic
1186234330 X:7491226-7491248 AAGGGAGTGGAGGCCGGGCGCGG + Intergenic
1186718057 X:12274717-12274739 CATGTACAGAAGGCGGGGCGCGG + Intronic
1186801469 X:13096577-13096599 TATACAGAGGAGGCCGGGCGTGG - Intergenic
1186825433 X:13335059-13335081 TATGAAGATCTGGCCGGGCGTGG - Intergenic
1187340961 X:18421146-18421168 AATGGAGATGAAGCCGGGCGCGG - Intergenic
1187804888 X:23108473-23108495 GATGGTGGCAAGGCCGGGCGCGG - Intergenic
1187863388 X:23702539-23702561 TCTGCAGCCAAGGCCGGGCGCGG - Exonic
1188390016 X:29608534-29608556 TAAGAGGAGGAGGCCGGGCGCGG + Intronic
1188479687 X:30624476-30624498 GATGGGAATAAGGCCGGGCGCGG + Intergenic
1188522662 X:31056410-31056432 TATGTATATAAGGCCAGGCGTGG + Intergenic
1189790686 X:44600732-44600754 TATGAAGGGCAGGCCGGGCACGG - Intergenic
1189919176 X:45886719-45886741 TAAGCAGAGTGGGCCGGGCGTGG + Intergenic
1190229482 X:48571122-48571144 TTAGAAGAGAAGGCCGGGCACGG + Intergenic
1190958795 X:55224909-55224931 AATGCAAAGAAGGCCGGGTGCGG - Intronic
1192175292 X:68881241-68881263 TATGGAGAACAGGCTGGGGGAGG + Intergenic
1192227768 X:69241172-69241194 TCTGGAGAGAAGGCTGAGAGAGG + Intergenic
1192431431 X:71114799-71114821 AAAGGAGTGGAGGCCGGGCGCGG + Intergenic
1192433134 X:71125942-71125964 TATGGAGAGAAGGCTATGGGAGG - Intronic
1192489372 X:71561216-71561238 AATGGTGAGTAGGCCGGGCATGG - Intronic
1192495490 X:71614270-71614292 AAGGCAGAAAAGGCCGGGCGAGG - Intergenic
1194284169 X:91989270-91989292 GAAGAAAAGAAGGCCGGGCGCGG + Intronic
1194305003 X:92233003-92233025 TATTTAGGGCAGGCCGGGCGCGG - Intronic
1194362914 X:92976726-92976748 TATGGGTAGCTGGCCGGGCGCGG - Intergenic
1194658927 X:96606729-96606751 TATGGAGAGAAGGCAGGGCTTGG - Intergenic
1194731946 X:97465135-97465157 TATGTAGCCATGGCCGGGCGCGG - Intronic
1194817746 X:98464802-98464824 AATGAAAAGCAGGCCGGGCGTGG - Intergenic
1195660542 X:107373688-107373710 TATAGAAAGAAGGCTGGGTGTGG + Intergenic
1196301584 X:114054565-114054587 TATGTTGAGAAGGCCGGGCGTGG - Intergenic
1196308886 X:114137666-114137688 TATAGAGTGCTGGCCGGGCGCGG + Intergenic
1196503988 X:116418927-116418949 AAGAGAGAGAAGGCTGGGCGCGG - Intergenic
1196833664 X:119795690-119795712 TTTGGAAAAATGGCCGGGCGTGG + Intergenic
1197201278 X:123750930-123750952 AAAGAAAAGAAGGCCGGGCGTGG + Intergenic
1197204662 X:123779360-123779382 AAAGGAGACTAGGCCGGGCGCGG - Intergenic
1197496332 X:127186232-127186254 TAAAGACAGAAGGCCGGGCACGG - Intergenic
1198194881 X:134350366-134350388 TAAGAAGATAAGGCCGGGCGCGG + Intergenic
1198253526 X:134905067-134905089 AAGGGAGATAAGGCCGGGCGCGG + Intronic
1198777759 X:140198896-140198918 AAAGGAGTGCAGGCCGGGCGTGG - Intergenic
1198866543 X:141129313-141129335 AAATGAGAGAAGGCCAGGCGCGG + Intergenic
1199542744 X:148975652-148975674 TATGAAAGTAAGGCCGGGCGCGG + Intronic
1199694194 X:150331954-150331976 TATGGGGAGAAGGCTGGGCATGG - Intergenic
1200328311 X:155265629-155265651 TACACATAGAAGGCCGGGCGCGG - Intergenic
1200466472 Y:3526587-3526609 TAAAGAAACAAGGCCGGGCGCGG - Intergenic
1200671157 Y:6092955-6092977 TATGGGTAGCTGGCCGGGCGCGG - Intergenic