ID: 986608120

View in Genome Browser
Species Human (GRCh38)
Location 5:9543674-9543696
Sequence TGTATACTCATTGAAGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986608120_986608124 9 Left 986608120 5:9543674-9543696 CCCCACACTTCAATGAGTATACA 0: 1
1: 0
2: 0
3: 17
4: 179
Right 986608124 5:9543706-9543728 TGTGACTGCATGGAGCAACGTGG 0: 1
1: 0
2: 1
3: 8
4: 145
986608120_986608123 -1 Left 986608120 5:9543674-9543696 CCCCACACTTCAATGAGTATACA 0: 1
1: 0
2: 0
3: 17
4: 179
Right 986608123 5:9543696-9543718 AGATGCTTAGTGTGACTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986608120 Original CRISPR TGTATACTCATTGAAGTGTG GGG (reversed) Intronic
900915316 1:5634111-5634133 TGTATATTTATTCATGTGTGTGG + Intergenic
907120630 1:52004993-52005015 TGTATACATATTGAAAAGTGAGG - Intergenic
909327466 1:74368959-74368981 TGTATACACATCCATGTGTGTGG + Intronic
909898000 1:81098116-81098138 TGTTTATTCATTGGAGTGTATGG - Intergenic
909937819 1:81574201-81574223 TGAATACTTATAGAAGTGGGTGG + Intronic
910023083 1:82616644-82616666 TGTATAGTCAATGAAGTAGGAGG - Intergenic
916039439 1:160949785-160949807 TGTATACTCTTATAATTGTGGGG - Intronic
916731837 1:167573492-167573514 TGTGGACTCATTGAAAAGTGAGG - Intergenic
918973607 1:191450544-191450566 TGTATCCTTATTGAAATTTGTGG - Intergenic
921083257 1:211761477-211761499 TTTATCTTCATGGAAGTGTGAGG + Intronic
921109848 1:212024923-212024945 TGTAGTCTAATTGAAGTTTGAGG - Intronic
922501045 1:226097096-226097118 TGTGAAGTCATTGAAGTTTGGGG - Intergenic
1064179892 10:13105298-13105320 TGTATATGCATTGAAGGGTGGGG + Intronic
1065424225 10:25582300-25582322 TGGATACACATTAAAGAGTGGGG - Intronic
1065429952 10:25643548-25643570 TGTATTATCATGGAAGTGAGAGG + Intergenic
1065713674 10:28543088-28543110 AGTATACACATTCAAGTTTGAGG - Intronic
1066050097 10:31626153-31626175 TGTATACACATGGAAGTGGAGGG - Intergenic
1069172377 10:65248569-65248591 TGTATACTCATGAGAGTGTTAGG - Intergenic
1069866585 10:71507322-71507344 TGTATACTCCTAGAAGTCAGGGG + Intronic
1071300081 10:84249760-84249782 TGAAGCCTCATGGAAGTGTGGGG - Intronic
1072165759 10:92811631-92811653 TGTATACTCAATGAAGAGAATGG + Intergenic
1072989309 10:100175957-100175979 TGTAAACTTCCTGAAGTGTGTGG + Exonic
1073340251 10:102738835-102738857 ATTATACCCATTAAAGTGTGTGG - Exonic
1073727855 10:106255289-106255311 TGTACACTGATTGTAGTCTGTGG - Intergenic
1074417371 10:113278959-113278981 TGTACACTCATGGAAATATGAGG - Intergenic
1075188833 10:120287486-120287508 CTTATACACATTGAAGTTTGAGG - Intergenic
1075856466 10:125634110-125634132 TGTATATTCATTTAAGGGAGGGG + Intronic
1076531873 10:131150290-131150312 TCTAGAGTCACTGAAGTGTGGGG + Intronic
1079951676 11:26813426-26813448 TATATTCTCATGGAAGTTTGAGG + Intergenic
1080756234 11:35202070-35202092 TGTGTGTTCATTGAAATGTGTGG + Intronic
1081333573 11:41834952-41834974 TGTATGCACATTGAAGTTTGAGG + Intergenic
1085917175 11:80903578-80903600 TGTATACTCTTGGAAGTTTTAGG + Intergenic
1087120028 11:94564081-94564103 TGCACACACATTGAAGGGTGAGG + Intronic
1087462850 11:98467001-98467023 TGCAGACACATTGAAGGGTGAGG - Intergenic
1087492787 11:98849164-98849186 TGTGGACACATTGAAGGGTGAGG - Intergenic
1088095862 11:106100871-106100893 TGTATACTCCTTGAGAAGTGTGG - Intergenic
1090706157 11:129338849-129338871 TGCAGACACATTGAAGAGTGAGG - Intergenic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1093534418 12:20206261-20206283 TGGATATTCATTTAAGTGTATGG + Intergenic
1094686460 12:32721243-32721265 TGAATACCCACTGATGTGTGGGG + Intronic
1096863423 12:54546717-54546739 TGACAACTCATTGAGGTGTGGGG - Exonic
1102325952 12:111983950-111983972 TGTATAATCATTTTAATGTGCGG - Intronic
1103971092 12:124672988-124673010 TGTATACACATGGGTGTGTGGGG - Intergenic
1106671889 13:31914941-31914963 TTTATTCTCATTGCAGTGGGAGG + Intergenic
1107623543 13:42259100-42259122 TGCAGACACATTGAAGGGTGGGG - Intergenic
1107689310 13:42935950-42935972 TCTATTCTCAATGAAGTATGAGG - Intronic
1111168113 13:84490245-84490267 TGTATACTCCCTGCTGTGTGAGG - Intergenic
1111963834 13:94840510-94840532 TGTAAACTCCTTGAAATATGGGG - Intergenic
1112152194 13:96775865-96775887 TGTATACTCATTTGATTTTGGGG - Intronic
1116582285 14:46657527-46657549 TATATACACATTGAGTTGTGAGG - Intergenic
1118093961 14:62515791-62515813 TGTTTCCTCATTGAAGATTGTGG + Intergenic
1118172830 14:63405960-63405982 TGTGTACTCACTTAAGTGTTTGG - Intronic
1118601999 14:67477361-67477383 TTTATACTCATGGAAGTGAGAGG - Intronic
1120421424 14:84291155-84291177 TGTAAACTAATTGAATTGAGAGG + Intergenic
1121226561 14:92325428-92325450 TGTGTGCACATTCAAGTGTGAGG + Intronic
1122063330 14:99152585-99152607 TATATACTCAGTTAAGTGTAAGG + Intergenic
1125876120 15:43146844-43146866 TGTTTACTCCATAAAGTGTGAGG - Intronic
1129642555 15:77394711-77394733 TGTTTGGTCATTGAAGTGTTAGG - Intronic
1131744933 15:95436996-95437018 TGTTTCCTCAATGAAGTGTGAGG - Intergenic
1131753180 15:95531894-95531916 TGTAAACACACAGAAGTGTGTGG - Intergenic
1132265083 15:100463044-100463066 TGTATATTCATACATGTGTGTGG + Intronic
1133604450 16:7372463-7372485 TGTAAGCTCATTGAAGCCTGTGG + Intronic
1134681673 16:16130438-16130460 TTTTTACTCACTGCAGTGTGAGG + Intronic
1138664410 16:58552576-58552598 AGTATATTCATTCAAGTGAGTGG - Intronic
1140259195 16:73362518-73362540 TTTACACTCTGTGAAGTGTGTGG - Intergenic
1144369497 17:14576697-14576719 TGTATACTGAGTGATGTGTTTGG + Intergenic
1146356708 17:32140640-32140662 TTTCCACTCATTGAGGTGTGGGG + Intergenic
1149056825 17:52376495-52376517 TGCAGACACATTGAAGGGTGAGG - Intergenic
1149772759 17:59333727-59333749 TTTATACACATTTAAGTTTGAGG - Intronic
1150140084 17:62720683-62720705 AGAAAACTCACTGAAGTGTGGGG + Intronic
1152163408 17:78683969-78683991 TGTATACTCTTTGACTGGTGAGG + Intronic
1152882631 17:82828125-82828147 TGTATGCACATTCAACTGTGTGG - Intronic
1152882772 17:82829339-82829361 TGTATGCACATTCAATTGTGTGG - Intronic
1153704614 18:7733032-7733054 TGTAGACACATTGAAGGGTGAGG + Intronic
1158035941 18:53030353-53030375 TATATACTCAATAAAGTGTGTGG + Intronic
1159539353 18:69755834-69755856 TGTGAACACATTGAAGGGTGAGG + Intronic
1165348663 19:35265044-35265066 TTTATAGTCATTGAAGTCAGTGG + Intronic
1168605485 19:57756392-57756414 TGTATACTCACTGCATTGTGTGG + Exonic
926825251 2:16900022-16900044 TGTATATTTATTTAATTGTGAGG + Intergenic
928660247 2:33494602-33494624 TATATACTCACTATAGTGTGTGG + Intronic
928777715 2:34786817-34786839 TGTATGCTTATGGAAGTATGTGG + Intergenic
930093699 2:47550768-47550790 TGCATATTTACTGAAGTGTGGGG - Intronic
931327795 2:61244907-61244929 TGTTTACTCAGTGAATTCTGTGG - Intronic
931434655 2:62236085-62236107 TGTATAGTCATTGTGGGGTGTGG + Intergenic
932617149 2:73240109-73240131 GGTATATTAATTGATGTGTGAGG + Intronic
936969887 2:118167250-118167272 GGTATACATATTCAAGTGTGTGG + Intergenic
937491791 2:122377025-122377047 TGCATACACATTGCAGTGTTTGG - Intergenic
937753612 2:125508829-125508851 TGTATATTCATTGCTGTATGTGG + Intergenic
939546111 2:143555433-143555455 TGTATATTCTTTGATGTGTCTGG - Intronic
939712588 2:145541610-145541632 TGTATGCTTATTTATGTGTGTGG + Intergenic
940080855 2:149799494-149799516 TGTTTACTTAATGAAGTGTCTGG - Intergenic
941491321 2:166145370-166145392 TATATAGTCATTCAAGTATGAGG + Intergenic
942594658 2:177581381-177581403 TGTAGACTCATAGAAGAGAGAGG + Intergenic
943724860 2:191243223-191243245 TGTATACAAATTGAAGAGTGGGG - Intergenic
943927125 2:193799504-193799526 TGTGGACACATTGAAGTGTGAGG + Intergenic
944365968 2:198919983-198920005 TGCATACTCAGTGGAGTGTGGGG - Intergenic
944845499 2:203664061-203664083 TGTATATACATTAAAGTTTGAGG - Intergenic
945630532 2:212269740-212269762 TAAATAGTCATGGAAGTGTGAGG + Intronic
945803587 2:214464223-214464245 TGTATAGGCATTGAAGAGTTGGG + Intronic
946514404 2:220395781-220395803 TGTATAGTCAGTGGAGAGTGAGG + Intergenic
946656004 2:221948079-221948101 TGTAGACCCATGGCAGTGTGAGG + Intergenic
948934422 2:241153447-241153469 TGAATTCTCATTGACATGTGTGG + Intronic
1170276966 20:14602104-14602126 TGTGGACACATTGAAGGGTGAGG + Intronic
1173377906 20:42506341-42506363 GCTATGCTTATTGAAGTGTGTGG - Intronic
1177372555 21:20222721-20222743 TGTATACTAGTTGAAGTGATAGG + Intergenic
1178349550 21:31862844-31862866 TAGATAGTCATTGAAGTGTCTGG - Intergenic
1178590889 21:33908885-33908907 CGTTTGCACATTGAAGTGTGAGG - Intronic
1183114668 22:35681649-35681671 TGCAGACACATTGAAGGGTGAGG + Intergenic
1183144705 22:35979448-35979470 GGAATACACATTGAAGTGTTTGG + Intronic
1184186838 22:42870371-42870393 TGTAAACTGCTTGAAGTCTGTGG - Exonic
951111931 3:18813843-18813865 TCCATACTCATTGAAGTCAGGGG + Intergenic
951847490 3:27100413-27100435 TATGTCCTCCTTGAAGTGTGGGG + Intergenic
958266794 3:91447221-91447243 TGTAGACTTACTGAAGTGGGAGG + Intergenic
959022358 3:101201797-101201819 TTTACACTGATTGAAGTTTGAGG - Intergenic
959202637 3:103268812-103268834 TGCATACTCATTGAAAGGTGAGG + Intergenic
959462806 3:106647833-106647855 TCTATACTCATTCATGTCTGGGG + Intergenic
961423331 3:126825185-126825207 TGTATACTGCTTCTAGTGTGGGG + Intronic
961473022 3:127129472-127129494 TGTATACTCATTTATAAGTGAGG + Intergenic
963216534 3:142754812-142754834 TGTATATTCATTGAGGACTGTGG - Intronic
963508756 3:146221805-146221827 TGAATAATCTTTGAAGTTTGTGG - Intronic
965538211 3:169847075-169847097 TGAATAGTGATTGGAGTGTGGGG + Intronic
965656823 3:170995397-170995419 TGTGAACTCCTTGAAGTGTAGGG + Intergenic
967344361 3:188437446-188437468 TGTGTACATATTTAAGTGTGTGG - Intronic
970664040 4:18317190-18317212 TGTATACTCATGGGAGACTGAGG + Intergenic
975920929 4:79386425-79386447 CATCTATTCATTGAAGTGTGAGG + Intergenic
976569270 4:86590027-86590049 TATATGCTCATTGAAAAGTGAGG + Intronic
977932263 4:102761456-102761478 TGTTTACTCTTTGAAGGGCGGGG - Intergenic
979653809 4:123167700-123167722 GGTATATTCATAGAAGTTTGAGG - Intronic
982512280 4:156298004-156298026 TATATACTTATTAAAGTGTAAGG + Intergenic
983378103 4:166956100-166956122 TGTATAACCATAGAAGTGAGTGG - Intronic
983852935 4:172605777-172605799 TGTGGACACATTGAAGAGTGAGG + Intronic
984667599 4:182445817-182445839 TGTCTGCTCATGGAACTGTGGGG + Intronic
985030899 4:185788205-185788227 CGTAGACTCATTGAAGTGTCAGG + Intronic
986608120 5:9543674-9543696 TGTATACTCATTGAAGTGTGGGG - Intronic
988069864 5:26273993-26274015 TGCATACACATTGAAAGGTGAGG - Intergenic
988317871 5:29654504-29654526 TGTATAGTAATTGTATTGTGTGG + Intergenic
993292130 5:86087060-86087082 TGTTTACTCATTGAAGATTATGG - Intergenic
993455911 5:88126663-88126685 TGAATTCTCAATGAAGTCTGAGG - Intergenic
994320100 5:98385573-98385595 TGTCTAGGCATTGAAGAGTGAGG + Intergenic
996189762 5:120525532-120525554 TGTATATTCATAGTAGTCTGTGG - Intronic
996622386 5:125523174-125523196 TTCTTACTCATTGAAGTGTTGGG + Intergenic
997742571 5:136269924-136269946 TGGATTCACATTGAAATGTGTGG - Intronic
998674550 5:144392413-144392435 TGCAAAGTCATTGAAGTGTATGG + Intronic
1000921525 5:167144033-167144055 TGTATTCACATTGAAATGAGGGG + Intergenic
1000971053 5:167715033-167715055 TTTATACTGATTTTAGTGTGAGG + Intronic
1003159172 6:3620631-3620653 TGTATACACATGCATGTGTGTGG - Intergenic
1003622476 6:7713150-7713172 TGTAAACTCATTGAGGTCAGGGG + Intergenic
1004587116 6:17013259-17013281 TGCTTTCTCATTGAAATGTGTGG + Intergenic
1006764945 6:36496736-36496758 TGGAAACTCATCGAAGTTTGAGG + Exonic
1007558824 6:42788674-42788696 TGTTTTCTCAGTGAAGTCTGAGG + Intronic
1007884686 6:45213103-45213125 TATATGCTAATTGAATTGTGTGG - Intronic
1008988417 6:57574374-57574396 TGTAGACTTATTGAAGTGGGAGG - Intronic
1009177028 6:60472963-60472985 TGTAGACTTACTGAAGTGGGAGG - Intergenic
1009431664 6:63572690-63572712 TGTTTACTCATTGAAGATTGTGG - Exonic
1009705525 6:67245669-67245691 TGTATAATCATTGGACTTTGAGG - Intergenic
1009773464 6:68175222-68175244 TGTATAGTCCCTGAAGTATGAGG - Intergenic
1013877324 6:114848674-114848696 TGTATTCTAATTGCAGTCTGTGG + Intergenic
1015636722 6:135282924-135282946 TGAATACACATAGAAGTGTAAGG + Intergenic
1024438136 7:49382571-49382593 TGCAGACACTTTGAAGTGTGAGG - Intergenic
1024743647 7:52382790-52382812 TGCAGACACATTGAAGGGTGAGG + Intergenic
1025530325 7:61872592-61872614 TGAAAACTCATTGAAGTCAGTGG - Intergenic
1028102325 7:86836521-86836543 TGCCTACTAATGGAAGTGTGGGG + Intronic
1031249800 7:119365202-119365224 TGTAAGCTCATTCAAGTGTAGGG + Intergenic
1032632332 7:133667374-133667396 TCTATACTCACTGAGGTGTTGGG - Intronic
1033505011 7:141991288-141991310 TGTATATTGATGGAATTGTGTGG + Intronic
1033987328 7:147242471-147242493 TGTATATTCCTTGAAATCTGTGG + Intronic
1037029936 8:14092431-14092453 TTAATACTCATAAAAGTGTGTGG + Intronic
1037473037 8:19229319-19229341 TGTAAAATCGTTGAAGTTTGGGG + Intergenic
1038720639 8:30032466-30032488 TGTATTCTTCATGAAGTGTGAGG - Intergenic
1039024616 8:33244216-33244238 TTTATACACGTTGGAGTGTGTGG + Intergenic
1040904831 8:52457169-52457191 TGTTTATTCATTGAGATGTGGGG - Intronic
1040994133 8:53384560-53384582 TGTAGACGCATTGAAGGGTGAGG + Intergenic
1044219653 8:89654748-89654770 TGTAAACTCATTGATTTGGGAGG + Intergenic
1045447374 8:102281374-102281396 TGTTTGCTCATTGAAGCATGTGG - Exonic
1046489160 8:114925283-114925305 TGAATAATAATTGAAGTGAGGGG + Intergenic
1048450417 8:134528670-134528692 TTTAGAGTCATTGAAGTGTAAGG - Intronic
1048798357 8:138172430-138172452 TTTATACTCACTGAGGTCTGAGG - Intronic
1050098137 9:2088982-2089004 TGTATCATCATTGAAGGGGGTGG + Intronic
1051070454 9:13159839-13159861 TGTTTACTCATCTTAGTGTGTGG + Intronic
1051565082 9:18488409-18488431 TCTATACTCATTGAAGTAGGAGG - Intronic
1051740223 9:20244251-20244273 TGTAAACTCATTTTAGTGTCTGG - Intergenic
1052004067 9:23324975-23324997 TGTATCATCTTTGACGTGTGTGG - Intergenic
1052455734 9:28695000-28695022 TGTATACCCATTGAGCTGTCAGG + Intergenic
1055211826 9:73804288-73804310 GATATACTCATTGAAGGATGGGG - Intergenic
1055348378 9:75359976-75359998 TAAATACTCATAGAAGAGTGAGG - Intergenic
1055729984 9:79270621-79270643 TCTATACTCATTAAAGTTTGAGG - Intergenic
1058047799 9:100375704-100375726 TGCAGACACATTGAAGGGTGAGG + Intergenic
1058659037 9:107252006-107252028 TGTTTTCTCATTGAACTATGCGG - Intergenic
1061331264 9:129895331-129895353 TGTATACTCATTCACTTGGGAGG - Intronic
1189221854 X:39379010-39379032 TTTCTAATCATTGAGGTGTGGGG - Intergenic
1190502288 X:51091473-51091495 TGTTTACTCTGTGAAGTATGAGG + Intergenic
1191025837 X:55912238-55912260 TGGATACACACTGAAGTTTGAGG + Intergenic
1191613596 X:63143234-63143256 TGTCTGCTCATTGAAGAGTTAGG - Intergenic
1191622701 X:63235693-63235715 TGTCTGCTCATTGAAGAGTTAGG + Intergenic
1191638163 X:63400709-63400731 TGCAGACACATTGAAGGGTGAGG - Intergenic
1194969351 X:100325868-100325890 TGTACACACATAGAACTGTGTGG - Intronic
1197033743 X:121850016-121850038 TCTATAACCATTAAAGTGTGTGG - Intergenic