ID: 986608548

View in Genome Browser
Species Human (GRCh38)
Location 5:9545926-9545948
Sequence CCCTGCACGGGGAAGGTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 278}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986608535_986608548 5 Left 986608535 5:9545898-9545920 CCGGGATGAGCGACACTGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 75
Right 986608548 5:9545926-9545948 CCCTGCACGGGGAAGGTGGAGGG 0: 1
1: 0
2: 4
3: 23
4: 278
986608534_986608548 6 Left 986608534 5:9545897-9545919 CCCGGGATGAGCGACACTGGCCG 0: 1
1: 0
2: 1
3: 6
4: 66
Right 986608548 5:9545926-9545948 CCCTGCACGGGGAAGGTGGAGGG 0: 1
1: 0
2: 4
3: 23
4: 278
986608530_986608548 28 Left 986608530 5:9545875-9545897 CCTGGGTGGGAGAAGGGAGCGTC 0: 1
1: 0
2: 1
3: 23
4: 273
Right 986608548 5:9545926-9545948 CCCTGCACGGGGAAGGTGGAGGG 0: 1
1: 0
2: 4
3: 23
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986608548 Original CRISPR CCCTGCACGGGGAAGGTGGA GGG Exonic
900246526 1:1638671-1638693 CCCGGCACGGGGCAGGTGCAGGG + Intronic
900257753 1:1705813-1705835 CCCAGCACGGGGCAGGTGCAGGG + Intronic
900491577 1:2951918-2951940 CCCTGGACGGGACAGGCGGAAGG + Intergenic
900530303 1:3149763-3149785 TCCTGAGCGGTGAAGGTGGATGG - Intronic
900831127 1:4966435-4966457 CCCTGTACAGGGGAGCTGGAAGG - Intergenic
901317838 1:8320975-8320997 CCCAGCACAGGTGAGGTGGACGG - Intronic
902090424 1:13898559-13898581 CCCAGCTCGTGGAGGGTGGAAGG + Intergenic
903045668 1:20562663-20562685 CTCTGAACAGGGAAGGAGGAAGG - Intergenic
903344852 1:22677397-22677419 CCCTACAAGGGGAAGGGGAAAGG + Intergenic
904459381 1:30666524-30666546 CCCAGCTCGGAGAAGGTGGGGGG + Intergenic
906411820 1:45584643-45584665 CCTTGCACGAGGAAGGAGGCTGG + Intronic
907708221 1:56851367-56851389 GCCTGCACTGGGATGGGGGAGGG - Intergenic
910686743 1:89925429-89925451 CCATGGACGGGGGAGGGGGATGG - Intronic
910712650 1:90197557-90197579 CCTTCCATGGGGAAGGGGGATGG + Intergenic
914754890 1:150557064-150557086 CCCTGCACTTGGAAGGAGGAGGG + Intronic
914999387 1:152574186-152574208 CCCTGCAGAGAGAAGGGGGATGG + Intronic
915457950 1:156053316-156053338 CCTTGCACCGGGAAGGGGGAAGG - Intronic
915511929 1:156391254-156391276 CCCTGCCAGGGGAGGGTGGGTGG + Intergenic
915598942 1:156910399-156910421 CCCTGCTGGTGGCAGGTGGAAGG - Intronic
915909967 1:159908774-159908796 CCCTGCACGGCGGAGGTGGGAGG + Intergenic
919793224 1:201305712-201305734 CCCTATACTGGGAAGTTGGAGGG - Intronic
919880094 1:201895431-201895453 CCCAGTGCTGGGAAGGTGGAGGG + Intergenic
920195423 1:204223278-204223300 CACTGCGTGGGGAAGCTGGATGG + Intronic
920349497 1:205328583-205328605 CCAGGCACGGGGAAGGGGGGTGG - Intergenic
921148510 1:212381644-212381666 CCCAGGCCTGGGAAGGTGGAGGG - Intronic
924603364 1:245510832-245510854 AGCTGCACTGGGAAGGTGGCTGG + Intronic
924613481 1:245592374-245592396 ACCTGCCTGGCGAAGGTGGAAGG - Intronic
1063185489 10:3646891-3646913 CCATGCAGGAGGAAGGAGGAAGG + Intergenic
1063809727 10:9691287-9691309 CCCTGCACAGGGCTGGAGGAGGG - Intergenic
1063923447 10:10954326-10954348 CCTTGAACCTGGAAGGTGGAGGG - Intergenic
1064607768 10:17061643-17061665 CCCTGCCCTGGGAAGGAGGGAGG + Intronic
1066056085 10:31681418-31681440 CCCTGCACAGAGAAGGAGAAGGG - Intergenic
1066710179 10:38224635-38224657 TGCTGCACGCGGAAAGTGGAAGG + Intergenic
1066979826 10:42402773-42402795 TCCTGCACGCGGAAGGTGGAAGG - Intergenic
1069023747 10:63518819-63518841 CCCTCCAAGGGGAAACTGGAAGG - Intergenic
1069627534 10:69877398-69877420 ACCTGGCCGGGCAAGGTGGAGGG - Intronic
1069677087 10:70255874-70255896 CCCTGCGAGGGGACGGTGGGTGG + Intronic
1069910393 10:71755324-71755346 CCCTGCCTGGGGTGGGTGGACGG - Intronic
1069920938 10:71815313-71815335 CCCTGGGAGGGGACGGTGGATGG - Exonic
1070175789 10:73968138-73968160 CCCTTCAAGTGGAAGGTGGTGGG - Intergenic
1070792607 10:79198428-79198450 ACCTGCCTGGGGAAGGAGGAGGG - Intronic
1073425649 10:103454085-103454107 CCCTGCCCAGGGGAGGAGGAAGG + Exonic
1074162208 10:110844503-110844525 CCCTGCTGGGGGCAGGAGGATGG - Intergenic
1074542523 10:114376998-114377020 CCCAACACAGGGAAGGTGAAGGG + Intronic
1074855840 10:117472861-117472883 CTCAGCAAGGGGTAGGTGGAGGG + Intergenic
1076340392 10:129741444-129741466 CCCTGCATGGGAAAGGAGGCTGG + Intronic
1076747400 10:132521323-132521345 CCCTGAAAGGGGAGAGTGGAAGG + Intergenic
1077166367 11:1141265-1141287 CCCTCCACGGGCATGATGGAGGG - Intergenic
1077216433 11:1397092-1397114 CCCTGCACAGAGGAGGTGGCAGG - Intronic
1077833397 11:5900807-5900829 CCCACTACGAGGAAGGTGGAAGG - Exonic
1078498282 11:11842138-11842160 CCCTGCCGGGGGAGGGTGGAGGG - Exonic
1078613367 11:12841551-12841573 GCCTGGAGGGGGAATGTGGAGGG - Intronic
1079571487 11:21949094-21949116 TCCTGGATGGGGAAGTTGGAGGG - Intergenic
1080640544 11:34155899-34155921 CCCTGCATGGGGAGGGCAGAGGG - Intronic
1081720698 11:45286243-45286265 CCCGGCCCGGGGAAGGTGAGCGG - Exonic
1083174173 11:60938986-60939008 CCCAGCCCGGGGAAGGGGGTTGG + Intronic
1083871680 11:65492052-65492074 CCCTGCACTGGGCAGGGGGCGGG + Intergenic
1083890264 11:65592421-65592443 CCCTGTACGGGGAAGGGCGCCGG - Exonic
1084296001 11:68213652-68213674 CCCCGCCCGGGCACGGTGGAAGG + Intronic
1084650548 11:70486904-70486926 CCCTCCTCGGGGAACATGGAGGG + Intronic
1089494033 11:118899547-118899569 CCCAGCTCGGGGAGGGTGCAGGG + Intronic
1090450950 11:126805905-126805927 GGCCGCACGGAGAAGGTGGAGGG - Intronic
1091265414 11:134267155-134267177 CGCTGGATGTGGAAGGTGGAAGG + Intergenic
1091303270 11:134521476-134521498 GCCTGGGTGGGGAAGGTGGATGG - Intergenic
1091916583 12:4274698-4274720 CACTTCACCGGGGAGGTGGAGGG + Intronic
1094452976 12:30601646-30601668 CACTGCACAGGGATGGGGGATGG - Intergenic
1095739715 12:45593466-45593488 CGCTGCAAGGGGGAGGTAGAAGG + Intergenic
1101785900 12:107883291-107883313 CCCTGCTCTGGGAGAGTGGAAGG - Intergenic
1102351237 12:112193831-112193853 CTCTGCACCAGGATGGTGGAGGG + Intronic
1103032762 12:117630664-117630686 CCCAGCAGTGGAAAGGTGGATGG + Intronic
1103730813 12:123026650-123026672 CCCAGCAAGGCCAAGGTGGAAGG - Intronic
1104492787 12:129209186-129209208 CCCTGCCTGGGGTGGGTGGAGGG + Intronic
1104929469 12:132330049-132330071 CCCTGGACGGGGGAGAGGGAGGG - Intergenic
1105782697 13:23718039-23718061 CCCTGCTCTGGGAAGAAGGAAGG - Intergenic
1105884205 13:24628180-24628202 CCCAGCCTGGGGAAGGAGGAGGG - Intergenic
1107672860 13:42764360-42764382 TCCTGCACAGGAAAGGTGAAAGG + Intergenic
1107851844 13:44578118-44578140 CCCTGCCCGTGGAAGGGCGAGGG - Intergenic
1107893650 13:44936955-44936977 CCATGCACAGGGCAGGGGGATGG - Intergenic
1108698402 13:52923157-52923179 CCCTGCATGGGGGATGTTGAGGG + Intergenic
1111987346 13:95078512-95078534 CTTTGCACTGGGAAGGTGGCAGG + Intronic
1112476074 13:99731723-99731745 CCCTGGATGGGGAGGGAGGAAGG + Intronic
1113783008 13:112987232-112987254 CGCTGGAAGGGGCAGGTGGAGGG - Intronic
1113939739 13:114012373-114012395 CGGTGCACGGGGAGTGTGGAAGG - Intronic
1115085772 14:29513171-29513193 CTCTGCCAGGGCAAGGTGGAAGG - Intergenic
1116964525 14:51000508-51000530 CCCTCTACCGTGAAGGTGGATGG - Intronic
1118604332 14:67491904-67491926 CCTGGCATGGGGAAGGTGCATGG + Intronic
1120994584 14:90407086-90407108 CCCTGGAGGGGGAGGGTGTAGGG - Exonic
1122062117 14:99143089-99143111 CCCTGCACTGGGAAACTGGGGGG + Intergenic
1122228471 14:100293081-100293103 CCCTCCACGCGGAAGGGGGTCGG + Intronic
1122467616 14:101944967-101944989 CCCTGAACCTGGGAGGTGGAGGG + Intergenic
1122792756 14:104191283-104191305 CCCTGCACAGTGGAGGTGGGTGG + Intergenic
1124104977 15:26729348-26729370 CCAAGGAGGGGGAAGGTGGAGGG - Intronic
1124356155 15:28996374-28996396 CCATGCACAGGGAGGGAGGATGG - Intronic
1124420083 15:29513491-29513513 CCCTCCACGGAGAAGGTGGAGGG - Intronic
1124431815 15:29614728-29614750 GCCAGCACTGGGAAGGTAGAAGG + Intergenic
1125201006 15:37100648-37100670 TCCTCCACGGGGATGGGGGACGG + Intronic
1126440603 15:48683902-48683924 CTCTGCCTGGGGAAAGTGGAGGG + Intergenic
1127858979 15:62977266-62977288 ACCTGCAGGGGGGAGGTGTATGG + Intergenic
1128104253 15:65031430-65031452 GCTTGCACAGGGGAGGTGGAGGG - Intergenic
1129148549 15:73671779-73671801 CACAGCACGGGGAGGGTGAAAGG - Intergenic
1129269878 15:74413980-74414002 CCCTGCTGGGGGAAGCTGGGTGG - Intronic
1130010512 15:80149846-80149868 GCCTGCACTGGGAAGCAGGATGG - Intergenic
1130662269 15:85840161-85840183 CCCTCCACGAAGAAGCTGGAAGG + Intergenic
1132099867 15:99015421-99015443 CCCGGCGCAGGGAAGGTGGCGGG - Intergenic
1132861072 16:2072059-2072081 AGCTGCTCGGGGAAGGGGGAAGG - Intronic
1132980908 16:2738272-2738294 CCCAGCACGGGGATGGAGGCTGG + Intergenic
1133715414 16:8442703-8442725 CTCGGCAGGTGGAAGGTGGAAGG + Intergenic
1134005974 16:10818991-10819013 CCCGGCCCGGGGGATGTGGAAGG + Intergenic
1134006025 16:10819148-10819170 CCCGGCCCGGGGGATGTGGAAGG - Intergenic
1134407177 16:13970641-13970663 CACTGCTGGGGGAAGGAGGAAGG + Intergenic
1134438799 16:14285458-14285480 CCCTGCAAGGCGGCGGTGGACGG + Intergenic
1136092983 16:27933935-27933957 CCCTCCACGGGGAGGATGAAGGG + Intronic
1136286677 16:29248287-29248309 CCCTGTGCAGGGCAGGTGGATGG - Intergenic
1138231205 16:55337768-55337790 CACTGAAGGGGGAAAGTGGATGG - Intergenic
1138799657 16:60012713-60012735 CCCAGCAAGAGGAATGTGGAAGG + Intergenic
1139288030 16:65832832-65832854 CTCTGCTCAGGGAAGGTGGTAGG + Intergenic
1139647582 16:68342740-68342762 CCAGGCACCTGGAAGGTGGAGGG - Intronic
1139748050 16:69090250-69090272 GCCAGCACGGGGGAGGTGGTAGG - Intergenic
1139891035 16:70253473-70253495 CCCTGCTCTGGGAAGGGGTAGGG - Intronic
1141010182 16:80389602-80389624 CCCTGCTCTGGGAAGGAGGGAGG - Intergenic
1141646784 16:85371784-85371806 CCCTCCACGGGAAAGGAGGGTGG - Intergenic
1142018482 16:87765473-87765495 CCCTTCAGAGGGAGGGTGGAGGG + Intronic
1142092274 16:88220921-88220943 CCCTGTACAGGGCAGGTGGATGG - Intergenic
1142147420 16:88498375-88498397 CCCTGGACGTGTATGGTGGAGGG + Intronic
1143020906 17:3916804-3916826 CCCTGGTGGGGGAGGGTGGAGGG - Intergenic
1143347982 17:6264063-6264085 AACTACACGAGGAAGGTGGAAGG + Intergenic
1146289430 17:31597163-31597185 CCCTGCAGGGGGAAGAGGTAAGG + Intergenic
1146662191 17:34672314-34672336 CCCAGCACTGGGAAGGCAGAAGG + Intergenic
1146920251 17:36705284-36705306 CCCTGCCCAGGGAAGGGGGGTGG - Intergenic
1147651256 17:42063179-42063201 CCCAGCCCGAGGATGGTGGAAGG + Intronic
1147718070 17:42521434-42521456 CAATGCACGGGGAAGATGAAAGG - Exonic
1147841486 17:43374972-43374994 CCCTGGAAGTGGATGGTGGATGG + Intergenic
1148076017 17:44935542-44935564 CCCTGCAGCGGGAACATGGAGGG - Intronic
1148442286 17:47717564-47717586 CCCTGCATGGGTGAGGGGGAAGG + Intergenic
1148480579 17:47957297-47957319 CCCTGCAGAGGGATGGGGGAGGG - Intronic
1148755928 17:49972901-49972923 CGCTCCACGCGGAAGGTAGAGGG + Intronic
1148836608 17:50469006-50469028 CCCTCCACGGGGAAGGGGGCGGG + Intronic
1149600559 17:57890611-57890633 TCCTTCACAGGGGAGGTGGAGGG - Intronic
1151327204 17:73386635-73386657 CCCTGCTCGGGAAAGGGGGCAGG + Intronic
1152659707 17:81536567-81536589 GCCTGGACAGGGAAGGTGGCGGG + Exonic
1152697973 17:81805763-81805785 ACCTGGACTGTGAAGGTGGAGGG + Intronic
1152744920 17:82034110-82034132 CCCTGGAGGGGGAGGGTGGGGGG + Exonic
1152895376 17:82907882-82907904 CCCTGCCTGGGGAGGGTGGGAGG - Intronic
1153774044 18:8437338-8437360 CCCTGCTGGGAGAGGGTGGAGGG - Intergenic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1157449063 18:47772081-47772103 CACTGCACATGGAGGGTGGAAGG + Intergenic
1158002349 18:52633971-52633993 CCCTGCTCATGGCAGGTGGATGG + Intronic
1158343826 18:56494428-56494450 CCTGGCACGGGGAGGGTCGAAGG + Intergenic
1160899859 19:1422215-1422237 CCCTGAGCGGGGGAGGTGCACGG - Intronic
1160965144 19:1744164-1744186 CCCAGCCCCAGGAAGGTGGAAGG + Intergenic
1161416540 19:4150247-4150269 CCCTGAATGGGGAAGGAGGGAGG + Intergenic
1161704870 19:5814958-5814980 CCCTGCACAGGCAATGTAGACGG + Intergenic
1162112123 19:8404945-8404967 CACTGCAGGGGTGAGGTGGAGGG - Intronic
1164526533 19:29017321-29017343 CCCTCCATGGAGAAGGAGGATGG - Intergenic
1164527366 19:29022128-29022150 CCCAGCACAGGGAAGGTGCGGGG - Intergenic
1165108179 19:33486653-33486675 CCCTGATCTGGGGAGGTGGAGGG + Intronic
1165128576 19:33618168-33618190 CCCTGCAGAGGAAAGGTGAAGGG - Intergenic
1165730608 19:38142501-38142523 CCCTGCCCTGGGAGGATGGACGG - Intronic
1166371293 19:42302600-42302622 CCCGGCACGGGGTGGGGGGAGGG + Exonic
1166674073 19:44728607-44728629 CTTTGCAAGGGCAAGGTGGATGG - Intergenic
1167462155 19:49631161-49631183 CTCTGCAGGGGGCATGTGGATGG + Intergenic
1168545152 19:57244056-57244078 CCCTGCATGGTGGAGGGGGAAGG - Intronic
1202682532 1_KI270712v1_random:20548-20570 ACCTGCAAGGAGAAGGAGGACGG - Intergenic
924962586 2:46940-46962 ACCTGCCCGGGGGAGGTGGGGGG - Intergenic
926053763 2:9761626-9761648 CCAGGCACGGGGAAGGTGCGTGG + Intergenic
929809150 2:45174198-45174220 GGATGCAAGGGGAAGGTGGAGGG + Intergenic
932699910 2:73985221-73985243 CCCGGCCCGGGGGAGGGGGAGGG + Intergenic
935201611 2:100861500-100861522 CCTTGGACAGGGAAGATGGAAGG + Intronic
937250638 2:120521688-120521710 AGCTGCAAGGGGCAGGTGGAGGG - Intergenic
939574504 2:143879950-143879972 TCCTGCACGGGGAAGTTTGGAGG + Intergenic
940807707 2:158206507-158206529 CCCTGAAAGGGGATGGAGGAGGG + Intronic
942523136 2:176825656-176825678 TCTTGCATGGGGAAGGAGGAAGG - Intergenic
946389876 2:219408899-219408921 TCCAGCTGGGGGAAGGTGGATGG + Intergenic
946415101 2:219536298-219536320 CCCTGCAGGGGGAGGCAGGAGGG + Intronic
948689308 2:239691887-239691909 CCCTGCTCCTGGAAGGTGGGGGG - Intergenic
948762716 2:240202761-240202783 CTCTGCAAGGGTGAGGTGGAGGG - Intergenic
948874925 2:240821063-240821085 CCCAGCCCTGGGACGGTGGAGGG - Intergenic
948885032 2:240878136-240878158 CCCTCCACGGGGAAGGTGAGAGG + Exonic
948942330 2:241202782-241202804 CCCTGCTCGGCCAAGGGGGAAGG - Intronic
949043364 2:241859282-241859304 CCCTGCCTGGGGAAGGTGGGTGG + Intergenic
1174564691 20:51456530-51456552 GCCTGCCCTGGGAAGGTGGCTGG - Intronic
1174771293 20:53302904-53302926 CCCTCCACGGCCAAGGTGGCTGG + Intronic
1175414452 20:58792632-58792654 CCAGGCACGGGGAAGGGGAATGG + Intergenic
1175643162 20:60648812-60648834 CCCTGCAGGGGGGAAGAGGAGGG - Intergenic
1175724356 20:61307597-61307619 TCCTGCCTGGGGCAGGTGGATGG - Intronic
1175895673 20:62334620-62334642 GCCTGCAGGGAGAAGGTGGGAGG + Exonic
1175943627 20:62549026-62549048 CTCTGCACTGGGCAGGTGCAGGG + Intergenic
1176077483 20:63254863-63254885 CCCCACACGGGGAAGGTTGATGG - Intronic
1176182551 20:63757820-63757842 CCCTGGACGGGGCGGGTGGAGGG - Intronic
1176182578 20:63757911-63757933 CTCTGGACGGGGCGGGTGGAGGG - Intronic
1176182587 20:63757942-63757964 CTCTGGACGGGGCGGGTGGAGGG - Intronic
1176182647 20:63758154-63758176 CTCTGGACGGGGCGGGTGGAGGG - Intronic
1176298250 21:5085749-5085771 CCCCGCACAGGGAGGGAGGAAGG + Intergenic
1176303844 21:5113377-5113399 GCCTGGCCGGGGAAGGTGGAGGG + Intergenic
1179185629 21:39083378-39083400 CCCTGCACGGGGGAGATGGGAGG - Intergenic
1179563682 21:42233345-42233367 CCCTCCACGGGGCAGGAGGGCGG - Intronic
1179853186 21:44148573-44148595 GCCTGGCCGGGGAAGGTGGAGGG - Intergenic
1179858778 21:44176200-44176222 CCCCGCACAGGGAGGGAGGAAGG - Intergenic
1180997024 22:19970742-19970764 CCCTGCAGAGGGAAAGGGGATGG + Exonic
1182657554 22:31902767-31902789 CCCCTCACGGGGAAGCTGGGAGG + Intronic
1183020787 22:35024274-35024296 CCCTGCGCGGCGGAGGTGGCTGG + Intergenic
1183467869 22:37988920-37988942 CTATGCACTGGGAAGGTGGAGGG + Intronic
1183469574 22:37998349-37998371 CCCTTCAAGGGGCAGGTGGAAGG - Intronic
1184423653 22:44396333-44396355 CCCTCCATGGGGGAGGTGGCGGG + Intergenic
1184606341 22:45576811-45576833 CCCTGTGTGGGGAGGGTGGAGGG - Intronic
1184789626 22:46691831-46691853 CCCTGCACCAGGACGGTGGGAGG + Intronic
1185190502 22:49433253-49433275 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190518 22:49433334-49433356 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190549 22:49433456-49433478 CCCAGCAGGGAGAGGGTGGATGG - Intronic
949933508 3:9098974-9098996 GCCTGCATGGGGAAGGAGGAGGG - Intronic
953920741 3:46949547-46949569 CCCTGGACTGGGCAGGTGGTGGG + Intronic
954100394 3:48367928-48367950 CCCTGCAGGGGGAAGGAGCTGGG - Intergenic
954570866 3:51639729-51639751 CCCTGCCTGGGGAAGGGGTAGGG + Intronic
955144849 3:56306999-56307021 CCATGCAGGGTGAAGGAGGATGG - Intronic
958862281 3:99458383-99458405 CCCTGCAGGGGAGAGGAGGAGGG + Intergenic
960737983 3:120801391-120801413 CCCTGGACAGGGAAGTTGGGTGG + Intergenic
960842625 3:121975769-121975791 CCCTGCATGCGGAAATTGGAAGG + Intergenic
960959694 3:123061519-123061541 CTCTGAACAGGGAAGGTGAAAGG - Intergenic
961536909 3:127576049-127576071 CCCTGCAGGGGCAAGCAGGAAGG + Exonic
962638928 3:137362369-137362391 CACTGCTGGGGGATGGTGGAAGG + Intergenic
963603258 3:147394774-147394796 CCCTTCCCGGGGAAGGTCCATGG - Intronic
963667868 3:148212512-148212534 CTCTGCACTGGGAAGAGGGAAGG + Intergenic
963947661 3:151163995-151164017 CCCGGCATGGGGAGGCTGGACGG - Exonic
966652343 3:182315345-182315367 CCCTGCACAGTGAAGAGGGATGG + Intergenic
967880288 3:194297027-194297049 CCCCGCACGGGGACTGAGGAGGG + Intergenic
968083389 3:195862893-195862915 CTCTGCACTGGGGAAGTGGACGG + Intergenic
968419708 4:473738-473760 CACAGCCCGGGGAAGGTGCAGGG + Intronic
968475510 4:804850-804872 GCCTCCACGGGAAAGGTGGGCGG + Intronic
969049552 4:4363006-4363028 CCCTGCAAGAGAAAGGCGGAGGG + Intronic
969059506 4:4423883-4423905 CACTGCTCGGGGAATGGGGAGGG + Intronic
969924781 4:10575598-10575620 CCCTGCACTGGGCAGGTGGGTGG + Intronic
974077909 4:57184481-57184503 CCCTGCACGGGGAGGGTCTCGGG + Intergenic
975629546 4:76386729-76386751 CACTGCTGGGGGATGGTGGAAGG - Intronic
978913683 4:114097074-114097096 CTCAGAATGGGGAAGGTGGAAGG - Intergenic
985532248 5:440893-440915 CCCAGCAGGTGGGAGGTGGACGG - Intergenic
985928515 5:3036107-3036129 CCCTGCAAGGCGGAGGTGGGAGG + Intergenic
986608548 5:9545926-9545948 CCCTGCACGGGGAAGGTGGAGGG + Exonic
986675048 5:10176861-10176883 CCCTAAATGTGGAAGGTGGAGGG + Intergenic
987212333 5:15695431-15695453 CCCTGCACTGGGAAGGTCTGTGG + Intronic
992518802 5:77525619-77525641 CCCTGCAAGGTGAAGGAAGAGGG - Intronic
994828550 5:104747224-104747246 CTCTGCTCGGGCAATGTGGAAGG + Intergenic
1001708958 5:173762617-173762639 GCTTGCACTGGGAAGATGGATGG + Intergenic
1001939926 5:175733145-175733167 CCGTGGAGGAGGAAGGTGGAGGG + Intergenic
1004839708 6:19569125-19569147 CCCAGCACTTGGAAGGTAGAAGG - Intergenic
1006520011 6:34565883-34565905 CCCTGCACGGGGAGAGGGGCTGG - Intergenic
1007026255 6:38578138-38578160 CCCTGGCCAGGGAAGGTAGAGGG - Intronic
1007832471 6:44649017-44649039 CCCTGGACTGGGAGGGTGGAAGG - Intergenic
1007840510 6:44712344-44712366 CCCTGTAGGAGGATGGTGGAAGG - Intergenic
1011809734 6:91117096-91117118 GCCTACACCAGGAAGGTGGAAGG - Intergenic
1012660595 6:101885641-101885663 CCCTGGACTGGGAAGGTGGAAGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014714582 6:124849253-124849275 CCCTGCTAGGGCAATGTGGAAGG + Intergenic
1019436855 7:1026786-1026808 CCCTCCACGGGGAGCGTGCAAGG - Intronic
1019488495 7:1300349-1300371 CACTGCAGGTGGAGGGTGGAAGG - Intergenic
1019522739 7:1468027-1468049 CCAGGCATGGGGAAGGAGGATGG - Intergenic
1019596086 7:1859011-1859033 GCCTGCATGGGAGAGGTGGAGGG + Intronic
1019740716 7:2671562-2671584 GCCTGCACGGGGGAGGCAGAGGG + Intergenic
1020133143 7:5570594-5570616 CCCTGCCCAGGGGAGGGGGATGG + Intergenic
1021356633 7:19658853-19658875 CCCTTCAAGGGGTAGGGGGAGGG - Intergenic
1021810216 7:24395723-24395745 GCCTTCACTGGGAAGGAGGATGG + Intergenic
1022466638 7:30656582-30656604 CCCTAGACAGGGAAGATGGATGG + Intronic
1022972780 7:35532540-35532562 CCCCGCACGGGGGAGATGAATGG - Intergenic
1023491048 7:40742395-40742417 CCATGGACGGGGATGGGGGATGG + Intronic
1027183222 7:75953853-75953875 CACTGCACGGGGTAGGAGAAGGG - Intronic
1027332250 7:77109585-77109607 ACCTGAACGTGAAAGGTGGAGGG + Intergenic
1028638340 7:93016043-93016065 CCCAGCAAAGGGAAGGGGGAGGG - Intergenic
1029783529 7:102761744-102761766 ACCTGAACGTGAAAGGTGGAGGG - Intronic
1033043229 7:137937400-137937422 CCCTGCAAGGGGAGGAGGGAGGG - Intronic
1034895780 7:154875579-154875601 CCCCGCAGGGAGAAGGTGGGAGG + Intronic
1035051130 7:155999566-155999588 CCCTGGGAGGGGAAGGTGGCTGG + Intergenic
1035158732 7:156935456-156935478 GCCTGCAGGGAGGAGGTGGAAGG + Intergenic
1037563146 8:20092812-20092834 CCATTCACATGGAAGGTGGAGGG - Intergenic
1038060513 8:23907257-23907279 CTCTTCAAGGGGAAGGTAGAAGG - Intergenic
1041662386 8:60412887-60412909 CCCAGCACTGGGCAGGAGGAGGG - Intergenic
1042191796 8:66194551-66194573 CTCTGGTCGGGGAAGGAGGAAGG + Intergenic
1042253057 8:66775377-66775399 CACTGCGCGGGCCAGGTGGAGGG + Intronic
1048237273 8:132703354-132703376 CCCTGCATGGGACAGATGGAGGG + Intronic
1049357944 8:142198012-142198034 CCCTGCACTGGGAAGGGGCGAGG - Intergenic
1050195409 9:3078030-3078052 CTCAAAACGGGGAAGGTGGAAGG - Intergenic
1051507016 9:17838565-17838587 CCTTTCACGGGAAGGGTGGATGG - Intergenic
1051943933 9:22542896-22542918 CATTGCATGGGGAAGGTGCAAGG - Intergenic
1053075736 9:35132864-35132886 CCCTGTATAGGGAAGGTGTAGGG - Intergenic
1053396538 9:37779519-37779541 CCCGGAACAGGGAAGGGGGAAGG + Intronic
1055945318 9:81687921-81687943 CCCCACTCGGGGAAGGTAGAGGG + Intronic
1057189711 9:93079879-93079901 CCCTGCTGGGTGTAGGTGGAGGG - Intronic
1058249196 9:102669734-102669756 CACTGCACGGGAATGGGGGAGGG + Intergenic
1060281550 9:122218966-122218988 CCCAACTCTGGGAAGGTGGAAGG - Intronic
1060406616 9:123376072-123376094 CCCTGCCCTGGGGAGGTGGCTGG - Intronic
1060587360 9:124795003-124795025 AGCTGCCCGGGGAAGGGGGATGG - Exonic
1060656696 9:125376887-125376909 CCCTGCTCCGGGCAGGTGGGAGG - Intergenic
1061090151 9:128421566-128421588 CCCAGCACGGGGGCGGTGGGGGG - Intronic
1061223690 9:129267532-129267554 CCCAGCAGGGGGCAAGTGGATGG + Intergenic
1061233473 9:129328444-129328466 CCCTGGAAGGGGAGGGAGGAAGG + Intergenic
1061507838 9:131041698-131041720 CCCTGCAAAGAGAATGTGGAAGG + Exonic
1061918104 9:133767752-133767774 AGCTGCACAGGGCAGGTGGATGG - Intronic
1185762811 X:2701279-2701301 CCATGGACTGGGAGGGTGGATGG - Intronic
1186569433 X:10698762-10698784 GCCTTTACGGGGAAGGAGGAAGG - Intronic
1187242874 X:17529588-17529610 GTCTGCACTGGGAATGTGGAAGG - Intronic
1189085570 X:38019710-38019732 CCCTCCACGTGGGAGGTGGAGGG - Intronic
1190258503 X:48783073-48783095 CCCTCCACGGGGATGGGGGAGGG + Intergenic
1193396496 X:80990173-80990195 CACTGCAAGGGGATGGAGGACGG - Intergenic
1194587611 X:95755483-95755505 GCCTGCAGGGGGAAGGTGGATGG - Intergenic
1195112715 X:101663950-101663972 CCCTGCATGGTGGAGGTGGTGGG + Intergenic
1196304706 X:114087444-114087466 CTCTGCATGTGGAAGGTGGAGGG + Intergenic
1196554323 X:117069741-117069763 CCCTGCACGGGGGAAGGGGGAGG + Intergenic
1200149079 X:153942726-153942748 CCCCACCTGGGGAAGGTGGAGGG - Intronic