ID: 986609281

View in Genome Browser
Species Human (GRCh38)
Location 5:9550861-9550883
Sequence AGGGCCCACTGGATGCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986609281_986609285 -3 Left 986609281 5:9550861-9550883 CCATCAAGCATCCAGTGGGCCCT No data
Right 986609285 5:9550881-9550903 CCTCCATCAAGTGTTGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986609281 Original CRISPR AGGGCCCACTGGATGCTTGA TGG (reversed) Intergenic
No off target data available for this crispr