ID: 986611775

View in Genome Browser
Species Human (GRCh38)
Location 5:9575589-9575611
Sequence ACTTTAGTACATAAGCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986611775_986611777 7 Left 986611775 5:9575589-9575611 CCACAGTGCTTATGTACTAAAGT No data
Right 986611777 5:9575619-9575641 CTGAGCTGCTTTTACTGGCGTGG No data
986611775_986611776 2 Left 986611775 5:9575589-9575611 CCACAGTGCTTATGTACTAAAGT No data
Right 986611776 5:9575614-9575636 AAACGCTGAGCTGCTTTTACTGG No data
986611775_986611778 15 Left 986611775 5:9575589-9575611 CCACAGTGCTTATGTACTAAAGT No data
Right 986611778 5:9575627-9575649 CTTTTACTGGCGTGGAGCAGTGG No data
986611775_986611779 28 Left 986611775 5:9575589-9575611 CCACAGTGCTTATGTACTAAAGT No data
Right 986611779 5:9575640-9575662 GGAGCAGTGGCTCACAGTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986611775 Original CRISPR ACTTTAGTACATAAGCACTG TGG (reversed) Intergenic
No off target data available for this crispr