ID: 986611809

View in Genome Browser
Species Human (GRCh38)
Location 5:9575823-9575845
Sequence AAGTCTCACTTTGAGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986611801_986611809 8 Left 986611801 5:9575792-9575814 CCTTGATCATCCCATGAGGTCCC No data
Right 986611809 5:9575823-9575845 AAGTCTCACTTTGAGGAACAAGG No data
986611802_986611809 -2 Left 986611802 5:9575802-9575824 CCCATGAGGTCCCATCCCAGAAA No data
Right 986611809 5:9575823-9575845 AAGTCTCACTTTGAGGAACAAGG No data
986611799_986611809 13 Left 986611799 5:9575787-9575809 CCACTCCTTGATCATCCCATGAG No data
Right 986611809 5:9575823-9575845 AAGTCTCACTTTGAGGAACAAGG No data
986611803_986611809 -3 Left 986611803 5:9575803-9575825 CCATGAGGTCCCATCCCAGAAAG No data
Right 986611809 5:9575823-9575845 AAGTCTCACTTTGAGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986611809 Original CRISPR AAGTCTCACTTTGAGGAACA AGG Intergenic
No off target data available for this crispr