ID: 986612087

View in Genome Browser
Species Human (GRCh38)
Location 5:9579047-9579069
Sequence AGAAACATCTTGACATCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986612087_986612091 23 Left 986612087 5:9579047-9579069 CCCAGAGATGTCAAGATGTTTCT No data
Right 986612091 5:9579093-9579115 GAAATGCTTGGATTTGAACATGG No data
986612087_986612093 28 Left 986612087 5:9579047-9579069 CCCAGAGATGTCAAGATGTTTCT No data
Right 986612093 5:9579098-9579120 GCTTGGATTTGAACATGGGTAGG No data
986612087_986612089 1 Left 986612087 5:9579047-9579069 CCCAGAGATGTCAAGATGTTTCT No data
Right 986612089 5:9579071-9579093 AAAGTCACACAGCTAATAAATGG No data
986612087_986612092 24 Left 986612087 5:9579047-9579069 CCCAGAGATGTCAAGATGTTTCT No data
Right 986612092 5:9579094-9579116 AAATGCTTGGATTTGAACATGGG No data
986612087_986612090 11 Left 986612087 5:9579047-9579069 CCCAGAGATGTCAAGATGTTTCT No data
Right 986612090 5:9579081-9579103 AGCTAATAAATGGAAATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986612087 Original CRISPR AGAAACATCTTGACATCTCT GGG (reversed) Intergenic