ID: 986612089

View in Genome Browser
Species Human (GRCh38)
Location 5:9579071-9579093
Sequence AAAGTCACACAGCTAATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5861
Summary {0: 13, 1: 50, 2: 372, 3: 1467, 4: 3959}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986612085_986612089 29 Left 986612085 5:9579019-9579041 CCCTCTTTTGTAGATATGGAAAC No data
Right 986612089 5:9579071-9579093 AAAGTCACACAGCTAATAAATGG 0: 13
1: 50
2: 372
3: 1467
4: 3959
986612086_986612089 28 Left 986612086 5:9579020-9579042 CCTCTTTTGTAGATATGGAAACT No data
Right 986612089 5:9579071-9579093 AAAGTCACACAGCTAATAAATGG 0: 13
1: 50
2: 372
3: 1467
4: 3959
986612084_986612089 30 Left 986612084 5:9579018-9579040 CCCCTCTTTTGTAGATATGGAAA No data
Right 986612089 5:9579071-9579093 AAAGTCACACAGCTAATAAATGG 0: 13
1: 50
2: 372
3: 1467
4: 3959
986612087_986612089 1 Left 986612087 5:9579047-9579069 CCCAGAGATGTCAAGATGTTTCT No data
Right 986612089 5:9579071-9579093 AAAGTCACACAGCTAATAAATGG 0: 13
1: 50
2: 372
3: 1467
4: 3959
986612088_986612089 0 Left 986612088 5:9579048-9579070 CCAGAGATGTCAAGATGTTTCTC No data
Right 986612089 5:9579071-9579093 AAAGTCACACAGCTAATAAATGG 0: 13
1: 50
2: 372
3: 1467
4: 3959

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986612089 Original CRISPR AAAGTCACACAGCTAATAAA TGG Intergenic
Too many off-targets to display for this crispr