ID: 986612093

View in Genome Browser
Species Human (GRCh38)
Location 5:9579098-9579120
Sequence GCTTGGATTTGAACATGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986612087_986612093 28 Left 986612087 5:9579047-9579069 CCCAGAGATGTCAAGATGTTTCT No data
Right 986612093 5:9579098-9579120 GCTTGGATTTGAACATGGGTAGG No data
986612088_986612093 27 Left 986612088 5:9579048-9579070 CCAGAGATGTCAAGATGTTTCTC No data
Right 986612093 5:9579098-9579120 GCTTGGATTTGAACATGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986612093 Original CRISPR GCTTGGATTTGAACATGGGT AGG Intergenic
No off target data available for this crispr