ID: 986613864

View in Genome Browser
Species Human (GRCh38)
Location 5:9597029-9597051
Sequence CTCCGAAGACAGCAGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986613860_986613864 10 Left 986613860 5:9596996-9597018 CCACTGTGGTCAGTGACAACGTG No data
Right 986613864 5:9597029-9597051 CTCCGAAGACAGCAGGGGCATGG No data
986613859_986613864 16 Left 986613859 5:9596990-9597012 CCAGTGCCACTGTGGTCAGTGAC No data
Right 986613864 5:9597029-9597051 CTCCGAAGACAGCAGGGGCATGG No data
986613857_986613864 25 Left 986613857 5:9596981-9597003 CCATGGAAACCAGTGCCACTGTG No data
Right 986613864 5:9597029-9597051 CTCCGAAGACAGCAGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986613864 Original CRISPR CTCCGAAGACAGCAGGGGCA TGG Intergenic
No off target data available for this crispr