ID: 986615924

View in Genome Browser
Species Human (GRCh38)
Location 5:9617456-9617478
Sequence AAATAGGCAGGCTCTCTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986615924_986615933 29 Left 986615924 5:9617456-9617478 CCTCTTAGAGAGCCTGCCTATTT No data
Right 986615933 5:9617508-9617530 GTACTGATGGATGGCCGTACTGG No data
986615924_986615932 20 Left 986615924 5:9617456-9617478 CCTCTTAGAGAGCCTGCCTATTT No data
Right 986615932 5:9617499-9617521 CTGTCTAAAGTACTGATGGATGG No data
986615924_986615931 16 Left 986615924 5:9617456-9617478 CCTCTTAGAGAGCCTGCCTATTT No data
Right 986615931 5:9617495-9617517 ACATCTGTCTAAAGTACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986615924 Original CRISPR AAATAGGCAGGCTCTCTAAG AGG (reversed) Intergenic
No off target data available for this crispr