ID: 986615926

View in Genome Browser
Species Human (GRCh38)
Location 5:9617468-9617490
Sequence AAAGGTCAAGCCAAATAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986615926_986615933 17 Left 986615926 5:9617468-9617490 CCTGCCTATTTGGCTTGACCTTT No data
Right 986615933 5:9617508-9617530 GTACTGATGGATGGCCGTACTGG No data
986615926_986615931 4 Left 986615926 5:9617468-9617490 CCTGCCTATTTGGCTTGACCTTT No data
Right 986615931 5:9617495-9617517 ACATCTGTCTAAAGTACTGATGG No data
986615926_986615932 8 Left 986615926 5:9617468-9617490 CCTGCCTATTTGGCTTGACCTTT No data
Right 986615932 5:9617499-9617521 CTGTCTAAAGTACTGATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986615926 Original CRISPR AAAGGTCAAGCCAAATAGGC AGG (reversed) Intergenic
No off target data available for this crispr