ID: 986615926 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:9617468-9617490 |
| Sequence | AAAGGTCAAGCCAAATAGGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 986615926_986615933 | 17 | Left | 986615926 | 5:9617468-9617490 | CCTGCCTATTTGGCTTGACCTTT | No data | ||
| Right | 986615933 | 5:9617508-9617530 | GTACTGATGGATGGCCGTACTGG | No data | ||||
| 986615926_986615931 | 4 | Left | 986615926 | 5:9617468-9617490 | CCTGCCTATTTGGCTTGACCTTT | No data | ||
| Right | 986615931 | 5:9617495-9617517 | ACATCTGTCTAAAGTACTGATGG | No data | ||||
| 986615926_986615932 | 8 | Left | 986615926 | 5:9617468-9617490 | CCTGCCTATTTGGCTTGACCTTT | No data | ||
| Right | 986615932 | 5:9617499-9617521 | CTGTCTAAAGTACTGATGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 986615926 | Original CRISPR | AAAGGTCAAGCCAAATAGGC AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||