ID: 986615928

View in Genome Browser
Species Human (GRCh38)
Location 5:9617486-9617508
Sequence CTTTAGACAGATGTAGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986615928_986615932 -10 Left 986615928 5:9617486-9617508 CCTTTCCCTACATCTGTCTAAAG No data
Right 986615932 5:9617499-9617521 CTGTCTAAAGTACTGATGGATGG No data
986615928_986615933 -1 Left 986615928 5:9617486-9617508 CCTTTCCCTACATCTGTCTAAAG No data
Right 986615933 5:9617508-9617530 GTACTGATGGATGGCCGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986615928 Original CRISPR CTTTAGACAGATGTAGGGAA AGG (reversed) Intergenic
No off target data available for this crispr