ID: 986615932

View in Genome Browser
Species Human (GRCh38)
Location 5:9617499-9617521
Sequence CTGTCTAAAGTACTGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986615926_986615932 8 Left 986615926 5:9617468-9617490 CCTGCCTATTTGGCTTGACCTTT No data
Right 986615932 5:9617499-9617521 CTGTCTAAAGTACTGATGGATGG No data
986615927_986615932 4 Left 986615927 5:9617472-9617494 CCTATTTGGCTTGACCTTTCCCT No data
Right 986615932 5:9617499-9617521 CTGTCTAAAGTACTGATGGATGG No data
986615928_986615932 -10 Left 986615928 5:9617486-9617508 CCTTTCCCTACATCTGTCTAAAG No data
Right 986615932 5:9617499-9617521 CTGTCTAAAGTACTGATGGATGG No data
986615924_986615932 20 Left 986615924 5:9617456-9617478 CCTCTTAGAGAGCCTGCCTATTT No data
Right 986615932 5:9617499-9617521 CTGTCTAAAGTACTGATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986615932 Original CRISPR CTGTCTAAAGTACTGATGGA TGG Intergenic
No off target data available for this crispr