ID: 986617884

View in Genome Browser
Species Human (GRCh38)
Location 5:9638777-9638799
Sequence GCTGTGGCAAGCCCCACTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 1, 2: 14, 3: 56, 4: 248}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986617884_986617896 16 Left 986617884 5:9638777-9638799 CCTTGAGTGGGGCTTGCCACAGC 0: 1
1: 1
2: 14
3: 56
4: 248
Right 986617896 5:9638816-9638838 GGTGGTGGTTCTCAGGCCAATGG 0: 2
1: 24
2: 77
3: 186
4: 377
986617884_986617897 17 Left 986617884 5:9638777-9638799 CCTTGAGTGGGGCTTGCCACAGC 0: 1
1: 1
2: 14
3: 56
4: 248
Right 986617897 5:9638817-9638839 GTGGTGGTTCTCAGGCCAATGGG 0: 2
1: 17
2: 26
3: 63
4: 174
986617884_986617895 9 Left 986617884 5:9638777-9638799 CCTTGAGTGGGGCTTGCCACAGC 0: 1
1: 1
2: 14
3: 56
4: 248
Right 986617895 5:9638809-9638831 GGATGGAGGTGGTGGTTCTCAGG 0: 1
1: 0
2: 5
3: 40
4: 344
986617884_986617898 18 Left 986617884 5:9638777-9638799 CCTTGAGTGGGGCTTGCCACAGC 0: 1
1: 1
2: 14
3: 56
4: 248
Right 986617898 5:9638818-9638840 TGGTGGTTCTCAGGCCAATGGGG 0: 2
1: 19
2: 25
3: 56
4: 203
986617884_986617889 -8 Left 986617884 5:9638777-9638799 CCTTGAGTGGGGCTTGCCACAGC 0: 1
1: 1
2: 14
3: 56
4: 248
Right 986617889 5:9638792-9638814 GCCACAGCCACTGTGGGGGATGG 0: 1
1: 2
2: 23
3: 71
4: 460
986617884_986617894 1 Left 986617884 5:9638777-9638799 CCTTGAGTGGGGCTTGCCACAGC 0: 1
1: 1
2: 14
3: 56
4: 248
Right 986617894 5:9638801-9638823 ACTGTGGGGGATGGAGGTGGTGG 0: 1
1: 0
2: 17
3: 147
4: 1714
986617884_986617891 -5 Left 986617884 5:9638777-9638799 CCTTGAGTGGGGCTTGCCACAGC 0: 1
1: 1
2: 14
3: 56
4: 248
Right 986617891 5:9638795-9638817 ACAGCCACTGTGGGGGATGGAGG 0: 2
1: 5
2: 21
3: 114
4: 546
986617884_986617892 -2 Left 986617884 5:9638777-9638799 CCTTGAGTGGGGCTTGCCACAGC 0: 1
1: 1
2: 14
3: 56
4: 248
Right 986617892 5:9638798-9638820 GCCACTGTGGGGGATGGAGGTGG 0: 1
1: 3
2: 12
3: 84
4: 741

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986617884 Original CRISPR GCTGTGGCAAGCCCCACTCA AGG (reversed) Intronic