ID: 986620346

View in Genome Browser
Species Human (GRCh38)
Location 5:9666449-9666471
Sequence ATTATATCTGGGAGGAACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986620340_986620346 27 Left 986620340 5:9666399-9666421 CCAACCACAGCTATGCTCTTAAT 0: 1
1: 0
2: 1
3: 10
4: 132
Right 986620346 5:9666449-9666471 ATTATATCTGGGAGGAACAAGGG 0: 1
1: 0
2: 1
3: 19
4: 261
986620341_986620346 23 Left 986620341 5:9666403-9666425 CCACAGCTATGCTCTTAATGTCT 0: 1
1: 0
2: 2
3: 26
4: 295
Right 986620346 5:9666449-9666471 ATTATATCTGGGAGGAACAAGGG 0: 1
1: 0
2: 1
3: 19
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986620346 Original CRISPR ATTATATCTGGGAGGAACAA GGG Intronic
901766456 1:11502816-11502838 ATGACCGCTGGGAGGAACAACGG + Exonic
902688968 1:18097729-18097751 AATATATCAGGGAAGAAGAAAGG - Intergenic
903096285 1:20978125-20978147 ATTATTTTTGAGAGTAACAATGG - Intronic
903605074 1:24569448-24569470 AGTCTAGCTGGGAAGAACAATGG - Intronic
909445006 1:75738922-75738944 ATTTTATCTGGTAGAAACAGGGG - Intronic
912006083 1:104903311-104903333 ATGAGATTTGGGAGGAAGAAGGG - Intergenic
914513810 1:148356590-148356612 TTTCTATCTGGGAGGAACTGGGG - Intergenic
915792264 1:158686145-158686167 ATTATACTTAGGAGGAATAATGG - Intronic
915818212 1:158992743-158992765 ATGAGATTTGGGAGGAACCATGG + Intergenic
917115900 1:171603260-171603282 ATTTGCTCGGGGAGGAACAAGGG - Intergenic
918718040 1:187817429-187817451 ATGAAATCTGGGAGGTACCAGGG - Intergenic
918931249 1:190859288-190859310 ATGATATTTGGGAGGGTCAAGGG + Intergenic
919216601 1:194564385-194564407 ATTATATCTGGGTCTAAAAAAGG + Intergenic
919256148 1:195127965-195127987 ATGAGATTTGGGAGGAACCAGGG - Intergenic
921282314 1:213578923-213578945 ATAATATTTGGGAGGGACCAGGG + Intergenic
921496779 1:215852469-215852491 ATGAGATCTGGGAGGGACCAGGG - Intronic
921669490 1:217910510-217910532 ATTATCTCTGTTAGGAACCAGGG + Intergenic
922069106 1:222173822-222173844 AAGATATTTGGGAGGAACCAGGG - Intergenic
1063048762 10:2422067-2422089 ATTATATGTGGGGGGAAATAGGG - Intergenic
1064452211 10:15452876-15452898 AATAGATATAGGAGGAACAATGG + Intergenic
1065534335 10:26702292-26702314 ATGAGATTTGGGAGGAGCAAGGG + Intronic
1065628923 10:27658142-27658164 CTTATTTCTGGGAATAACAATGG + Intergenic
1067691084 10:48502750-48502772 AATATTTATGGGAGGAAGAATGG - Intronic
1070534732 10:77367335-77367357 ATTTTATCTTGGAAGAACTATGG + Intronic
1071128017 10:82358356-82358378 ATTATATTTGGCAGCAATAAAGG + Intronic
1071815971 10:89233014-89233036 ATTCGGTCTGGGTGGAACAAGGG - Intronic
1078536430 11:12178873-12178895 ATTGCATGTGGGAGGAAGAAAGG - Intronic
1078561974 11:12380110-12380132 ATTATGTCTGTGAGGAATAGAGG - Intronic
1078655983 11:13239597-13239619 ATTTTACCTGTGAGGAACACGGG - Intergenic
1078795419 11:14587335-14587357 AGTAGATCTGGGAGAAAGAAGGG - Intronic
1080986110 11:37468072-37468094 ATTGTATTTAGAAGGAACAATGG - Intergenic
1082772195 11:57216721-57216743 TTTAATTCTGGGAGGCACAAGGG - Intergenic
1086090187 11:82997570-82997592 ATGATAGCTTGGAGGAATAAAGG - Intronic
1087570282 11:99918803-99918825 ATTAAAATAGGGAGGAACAAAGG - Intronic
1089916169 11:122159137-122159159 ATAAAATCTGGGAGGAACAACGG - Intergenic
1091136555 11:133196132-133196154 AATAAATGTAGGAGGAACAAGGG + Intronic
1093938041 12:25022085-25022107 ATTTTATCTAGGAGGACCCACGG - Intronic
1095122514 12:38436588-38436610 ATGAGATCTAGGAGGAACCAGGG - Intergenic
1095129517 12:38522769-38522791 ATTTTATCAGAGAAGAACAAAGG + Intergenic
1095155372 12:38846837-38846859 ATTATATGTAGTAGGAAAAATGG + Intronic
1095366378 12:41411249-41411271 CTTATATCTGGGGGTAACAGTGG - Intronic
1095554927 12:43490914-43490936 ATTAAATATGGGAGGAAGAAAGG - Intronic
1095705499 12:45232753-45232775 ATTATTTCAGCAAGGAACAAAGG - Intronic
1096317501 12:50581337-50581359 ATTATTTCTGAGAGCCACAAAGG - Intronic
1097355219 12:58593623-58593645 ATTTTATTTTGGAGGAACCAAGG + Intronic
1097687720 12:62706652-62706674 CATATATCTGGGAGGAAATAGGG + Intronic
1098428062 12:70388924-70388946 GTTATCTCTGGGTGGCACAAGGG - Intronic
1098483079 12:70988083-70988105 ATTATATCTAGGAGGTAACAAGG + Intergenic
1098578363 12:72070312-72070334 ATGAGATTTGGGAGGGACAAGGG - Intronic
1099339197 12:81406776-81406798 ATTAGTTCTGGGAGAAATAAAGG + Intronic
1100427506 12:94500895-94500917 ACTATTGCTGGGAGGCACAATGG + Intergenic
1100933730 12:99639467-99639489 ATGATATTTGGGAGGTACCAGGG + Intronic
1101853260 12:108421370-108421392 ATTACATCCTGGAGGAAAAATGG - Intergenic
1102707877 12:114897835-114897857 ATTAAATTTGGGAAGGACAACGG - Intergenic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1104228467 12:126860291-126860313 ATTCTATCAGGGAGGAAGAACGG + Intergenic
1104916993 12:132270804-132270826 ATTCTATCAGGGAGGAAGAGCGG + Intronic
1105808785 13:23975366-23975388 TTTCTATATGGGAGGAAAAAGGG - Intergenic
1106420242 13:29579939-29579961 ATCAGATCTAGTAGGAACAATGG - Intronic
1108462706 13:50683113-50683135 TTTAGATTTGTGAGGAACAAGGG + Intronic
1109159583 13:58955926-58955948 ATTATTTCTGGAGGGAAAAAGGG + Intergenic
1109870087 13:68322454-68322476 ATGATATCTGGGAGGAGCTACGG - Intergenic
1110630837 13:77706354-77706376 ACTAACTCTTGGAGGAACAAAGG - Intronic
1111089505 13:83424809-83424831 ATTTTATAAGGGAGGAAAAAAGG - Intergenic
1112732724 13:102384303-102384325 GGTATATTTGGGAGGTACAAAGG + Intronic
1112887037 13:104186869-104186891 ATTATATCTGGTAGTTACAGAGG + Intergenic
1112912291 13:104501908-104501930 CATATATCAGGGAGGAAGAAGGG - Intergenic
1115608937 14:35033786-35033808 ATGATATTTGGGAGGGACCAGGG - Intergenic
1115609183 14:35035227-35035249 ATGATATTTGGGAGGGACCAGGG - Intergenic
1115820428 14:37207067-37207089 ATGAGATTTGGGAGGAACCAGGG + Intronic
1116255869 14:42554560-42554582 ATTATATGTGGGAAGAAACATGG - Intergenic
1118980868 14:70715704-70715726 ATCCTATCAGGGAGGAAGAAAGG + Intergenic
1120480861 14:85047502-85047524 ATAAGATTTGGGAGGGACAAGGG + Intergenic
1121124307 14:91396072-91396094 ATTACATCTCGAAGGATCAAGGG + Intronic
1121141079 14:91542669-91542691 AATAAATCTGGGAGGATAAAGGG + Intergenic
1121239412 14:92418061-92418083 ATTATATTTGGGAGGACACAGGG - Intronic
1124021709 15:25931417-25931439 AGTATTTCTGAGGGGAACAAGGG + Intergenic
1124557280 15:30737532-30737554 AATATATTTGGGGGGAATAATGG + Intronic
1124673985 15:31668217-31668239 AATATATTTGGGGGGAATAATGG - Intronic
1126218846 15:46188613-46188635 TTTATATATGGGAGTAACATCGG + Intergenic
1127886442 15:63205535-63205557 ATGATATGTGGTAGGGACAAGGG + Intronic
1128708072 15:69851765-69851787 ATTCTTTCTGGGAGGAGGAAGGG + Intergenic
1128771596 15:70286772-70286794 GTTATATCTGGGAGTAGCATTGG - Intergenic
1129620305 15:77137814-77137836 ATGAGATCTGGGAGGGGCAAGGG + Intronic
1130545530 15:84855496-84855518 ATGATATCTTGGAGGAAAAAAGG + Intronic
1130640734 15:85672315-85672337 ATTGTATATAGGAGGAACTAAGG - Intronic
1131349090 15:91680202-91680224 ACAATATCTTGGAGAAACAATGG - Intergenic
1134336427 16:13303885-13303907 ATTAAGTCTGGGAAGAAGAAGGG - Intergenic
1134356624 16:13488188-13488210 ATTTAATCTGGGGGGAAGAATGG - Intergenic
1134379998 16:13715279-13715301 ATTATAGCTGGGAGACAAAAAGG - Intergenic
1140576451 16:76175499-76175521 ATAATATGGAGGAGGAACAAAGG + Intergenic
1140813703 16:78601716-78601738 CTTTTCTCTGGAAGGAACAAAGG + Intronic
1141264254 16:82481819-82481841 ATAATATCTTGGAGGAAGAAGGG + Intergenic
1141305981 16:82864720-82864742 ATGAGATTTGGGAGGAACCAGGG - Intronic
1144225472 17:13140728-13140750 ATTATCTCTGGGGGGCAGAAAGG + Intergenic
1146553717 17:33804842-33804864 ATTATTTCTGAGAGGAAGTATGG - Intronic
1147021327 17:37536206-37536228 CTGATATCTGTGAGAAACAATGG + Intronic
1147532888 17:41296678-41296700 GTTATATCTGAGATGAAAAAAGG + Intergenic
1148005578 17:44426191-44426213 CTGAGATCTGGGAAGAACAAAGG + Intronic
1148284624 17:46376604-46376626 ATTTTATCTGGTATGAATAATGG - Intergenic
1148306845 17:46594525-46594547 ATTTTATCTGGTATGAATAATGG - Intronic
1152860348 17:82692712-82692734 TTTAAATCTGGGAGCAGCAAAGG + Intronic
1153473365 18:5470233-5470255 TTTATATCTGGAAGGGACATTGG - Intronic
1154026821 18:10715810-10715832 ATATTATCTAGGAGGAAGAAAGG + Exonic
1154988039 18:21572604-21572626 ATTATATCCAGTAGGAAAAAAGG + Intronic
1155529179 18:26748498-26748520 AAAATATTTGGGAGGAATAAAGG - Intergenic
1156159157 18:34339069-34339091 ATTATAGTGGGAAGGAACAAGGG - Intergenic
1156472726 18:37387771-37387793 ATTACAGCTGGAAGGAGCAAAGG - Intronic
1156955739 18:42961063-42961085 ATTATATCTGGGATAAACAGAGG + Intronic
1157195209 18:45615251-45615273 ATAATATCTGGGAGGGGCCAGGG + Exonic
1159578427 18:70207225-70207247 ATTATCTCTGGGAAGAAGAGAGG + Intergenic
1159718083 18:71849989-71850011 ATGATATCTGAGAGGGACCAGGG + Intergenic
1162256490 19:9494355-9494377 ATCATATCTGCTAGGAACAAAGG + Intronic
1163867016 19:19782012-19782034 ATTAGCTCGGGGATGAACAAGGG + Intergenic
1164856318 19:31527438-31527460 GTTAAATCTGGGAGGAATGAAGG + Intergenic
925828148 2:7870577-7870599 ATTAGGTATTGGAGGAACAAAGG - Intergenic
927292140 2:21415156-21415178 AATAAATATGGGATGAACAAAGG + Intergenic
930579539 2:53193957-53193979 TTCATTTCTGGGAGGAGCAATGG - Intergenic
930711556 2:54555429-54555451 ACTGTATGTGGGAGGATCAAAGG - Intronic
930734489 2:54762577-54762599 AATAAATATGGAAGGAACAATGG - Intronic
930790179 2:55317343-55317365 ATTGTAACTGGGGGGAAAAAAGG + Exonic
930965851 2:57325730-57325752 ATCATGTCTGGGAGAAAAAAAGG - Intergenic
931905178 2:66834808-66834830 AATACGTCTGGAAGGAACAAGGG - Intergenic
933389417 2:81651746-81651768 ATTAGATGGAGGAGGAACAATGG + Intergenic
933548036 2:83739977-83739999 ATGATATTTGGGAGGGGCAAGGG - Intergenic
937282538 2:120730229-120730251 ATTATAAGTGGGAGGGACTAGGG - Intergenic
937360614 2:121227166-121227188 AATATATTGAGGAGGAACAAGGG + Intronic
937889587 2:126927078-126927100 ATGAGATTTGGGAGGAGCAAGGG + Intergenic
939102247 2:137908429-137908451 ATTATATCTGAAAGGTAGAAGGG + Intergenic
939736167 2:145849600-145849622 AAAATTTCTGTGAGGAACAAAGG + Intergenic
940238336 2:151535199-151535221 AATATATGTGGGAGTAACAATGG + Intronic
944987868 2:205199310-205199332 CTTATCTCAGGGAGGAAGAAAGG + Intronic
946209179 2:218133695-218133717 ACTAAATCTGAGAGGAACAGGGG + Intronic
947014627 2:225605101-225605123 ATTATATCTTTTAGGAAGAATGG + Intronic
947324513 2:228959774-228959796 ATTAAATCTGTGAGGAACTCTGG + Intronic
947443284 2:230141810-230141832 ATGAGATCTGGGAGGAGCCAGGG + Intergenic
1169027392 20:2382364-2382386 AGCAGATCTTGGAGGAACAAAGG - Intronic
1170496049 20:16926615-16926637 ATATTATCTGGGAGGAAAATTGG - Intergenic
1174764351 20:53238352-53238374 AGTATGTCTGTGAGGACCAAGGG + Intronic
1175358763 20:58390311-58390333 ATAGTATCTGGGAGAAACCAGGG - Intronic
1175737697 20:61398784-61398806 ATTATGTCTTGGAGGAAGATTGG + Intronic
1176670329 21:9728206-9728228 ATTATATATAGCAGGAAAAATGG - Intergenic
1176943410 21:14951145-14951167 ACTAAATCTGGGGGGAAAAAAGG + Intergenic
949116379 3:330733-330755 AAAATATCTTTGAGGAACAAAGG + Intronic
950498530 3:13349148-13349170 CTGACATCTGGGAAGAACAAGGG + Intronic
950580619 3:13859618-13859640 ATTATATCCGAGAGGGACAGGGG - Intronic
950776199 3:15352460-15352482 ATGAGATTTGGGAGGAACCAAGG + Intergenic
951838570 3:27008632-27008654 AATATTTCTGGGAGGCAGAAAGG - Intergenic
951898982 3:27638365-27638387 ATAATATCTGGGAAGCACAGAGG - Intergenic
953225919 3:41020681-41020703 ATTTTATAGGGGAGGAACTAAGG + Intergenic
954054941 3:48014867-48014889 ACCATCTCTGGGATGAACAATGG - Intronic
954838295 3:53490483-53490505 ATTATTTGTGGGAGGAAAAATGG + Intergenic
954972781 3:54664998-54665020 ATTATTTCTGGCTGGAACAATGG - Intronic
955324562 3:58000179-58000201 CTTACATCTGTGAGGATCAAAGG + Intergenic
956868305 3:73391009-73391031 TTTATATCAGTGAGGTACAAAGG - Exonic
957982394 3:87526277-87526299 ATGAGATTTGGGAGGAACCAGGG + Intergenic
958583084 3:96051828-96051850 ATTAGATTTGGGAGGAGCCATGG - Intergenic
959105839 3:102063596-102063618 GTTATATGTGGAAGAAACAAAGG - Intergenic
960572139 3:119195793-119195815 ATTATATGTGCTAGGAAAAAAGG - Intronic
960903186 3:122572451-122572473 ATTGTAAATGGGAGGAAAAAGGG + Exonic
963423264 3:145089449-145089471 ATACTATCTGGGAGGAATATGGG - Intergenic
968695496 4:2024008-2024030 ATTAATTCTGGGAGGAATCAGGG - Intronic
969151983 4:5177481-5177503 ATGAGATCTGGGAGGGACCAGGG - Intronic
970987523 4:22176058-22176080 ATGAGATTTGGGAGGGACAAGGG - Intergenic
971930226 4:33071710-33071732 ATGAGATTTGGGGGGAACAATGG + Intergenic
972102072 4:35432480-35432502 ATTAGATTTGGGAGGAGCCAGGG + Intergenic
972829786 4:42802045-42802067 ATGAGATCTGGGAGGAGCCAGGG - Intergenic
973107006 4:46352425-46352447 ATTATTTCTGGGAGGACCAGAGG - Intronic
973695014 4:53482176-53482198 ATTCTATCTGGGAAGAACTTAGG - Intronic
978331906 4:107622324-107622346 ATAGTATCTGGGAGAAAGAAGGG - Intronic
978700352 4:111636323-111636345 ACTATAACTTGGAGAAACAATGG + Intergenic
980023933 4:127742302-127742324 ATACTATCTGGGAGGCCCAAAGG - Intronic
980440112 4:132831524-132831546 ATTATATCTGGGAGGATGAGGGG + Intergenic
981258611 4:142692664-142692686 ATTCCTTCTGGGAAGAACAACGG + Intronic
982200507 4:152955859-152955881 ATTATGTCTGGGAAGAAGAGTGG - Intronic
982938719 4:161520615-161520637 ATTATATGTGGTTGGAACAAAGG + Intronic
985404448 4:189623328-189623350 ATTATATATAGCAGGAAAAATGG + Intergenic
985810162 5:2077143-2077165 ATTATATGTGGGAGCTAGAAAGG + Intergenic
986232864 5:5883106-5883128 ATTATTTTTGGTAGGAACTATGG - Intergenic
986620346 5:9666449-9666471 ATTATATCTGGGAGGAACAAGGG + Intronic
987455290 5:18137832-18137854 ATGATATTTGGGAGGGACCAAGG - Intergenic
988152465 5:27402992-27403014 ATTATATCTGGGAGCTTCTAGGG + Intergenic
988943773 5:36173633-36173655 GTTCTTTCTTGGAGGAACAAAGG - Intronic
990159713 5:52924152-52924174 AATATATCTGGTAGGAAGGAAGG - Intronic
990314440 5:54570916-54570938 ATTACATCTGTAAAGAACAATGG - Intergenic
991119317 5:62993490-62993512 ATGAGATTTGGGAGGAACCAGGG - Intergenic
991362757 5:65837906-65837928 TTTGTATCTGGCAGGCACAATGG - Intronic
991925946 5:71705104-71705126 ATTCTATGTGTGTGGAACAAAGG - Intergenic
992180032 5:74186819-74186841 ATGCTTTCGGGGAGGAACAAAGG - Intergenic
993844062 5:92918358-92918380 CTTTTTTCTGAGAGGAACAAGGG + Intergenic
994106142 5:95951436-95951458 ATTAAATCTGGGGGAAAAAATGG - Intronic
995601210 5:113798801-113798823 TTTATTTCTGGGAGACACAACGG - Intergenic
996928281 5:128855400-128855422 ATTGTACCTGTGAGGAGCAAGGG + Intronic
999023593 5:148199251-148199273 GTTATATTTGGGGGGAAAAAAGG - Intergenic
1001480090 5:172082546-172082568 TTTATACCTGGGAGGGACATGGG + Intronic
1001724543 5:173886104-173886126 ATTTTATCTAGAAGGAACCAAGG + Intergenic
1001804807 5:174574308-174574330 ATTATATTTGGGAGGAGGTATGG + Intergenic
1002869944 6:1157566-1157588 ATGAGATTTGGGAGGAACCAGGG + Intergenic
1003469233 6:6413298-6413320 ATAAAATCTAGGAGGAACAGAGG + Intergenic
1003509497 6:6767752-6767774 GATTTATCTGGAAGGAACAAGGG - Intergenic
1003715135 6:8637945-8637967 AGCATCTCTGGGAGGAACAAAGG + Intergenic
1004659997 6:17701881-17701903 ACTATATCTAGGAGGATTAAAGG + Intronic
1005585115 6:27268812-27268834 ATTATATGTGGAAGGATCATGGG - Intergenic
1009276880 6:61693998-61694020 ATGATATCTGGCAGGATCACTGG - Intronic
1009305213 6:62081115-62081137 AATATATCTAGGAAGAACAAAGG + Intronic
1009403562 6:63285429-63285451 AATGTGTTTGGGAGGAACAAGGG + Intronic
1009441532 6:63685781-63685803 ATGTTATCTGGAATGAACAATGG - Exonic
1009470068 6:64021577-64021599 GTTATAAGTAGGAGGAACAATGG + Intronic
1010122180 6:72388975-72388997 TGTATATTTGGGAGGCACAAGGG + Intronic
1012967244 6:105687828-105687850 ATGATATTTGGGAGGAGCCAGGG + Intergenic
1013395971 6:109740107-109740129 ATTCTACCTGGGAAGAACACAGG + Intronic
1013671765 6:112411399-112411421 ATTGTATCTGCTAAGAACAAGGG - Intergenic
1013994874 6:116296620-116296642 ATTATAAGTGGAATGAACAAAGG + Intronic
1014121737 6:117733880-117733902 ATTATGTGTGTGAGGAAGAATGG - Intergenic
1014357379 6:120429867-120429889 ATTTTATCTGGCACAAACAAAGG + Intergenic
1014583852 6:123172964-123172986 AATATATCTGTCAGGAATAATGG + Intergenic
1015514151 6:134068333-134068355 ATTATAGCTGGAAGGAAGGAAGG + Intergenic
1015995229 6:138989713-138989735 ATTTTAGATGGCAGGAACAAAGG - Intergenic
1016177684 6:141099945-141099967 ATGATATTTGGGAGGGACCAGGG + Intergenic
1018711634 6:166501578-166501600 AGGATACCTGGGAGGAGCAAAGG - Intronic
1020411055 7:7892051-7892073 AGTATATGATGGAGGAACAAGGG + Intronic
1021603380 7:22386880-22386902 ACTATATCTGGAAGGGAAAATGG + Intergenic
1022781543 7:33589576-33589598 ATGATATGTGAGAGGAAGAAGGG + Intronic
1023143994 7:37130700-37130722 ATGATACCTGGGAGTGACAAGGG + Intronic
1023690409 7:42780019-42780041 ATGATATTTGGGAGGAGCGAGGG + Intergenic
1024933069 7:54685028-54685050 CTTATATGTGGGAGCAAAAAAGG + Intergenic
1026403676 7:70042240-70042262 ATTATTTCTTGGAGGAAAAGAGG + Intronic
1026946735 7:74320990-74321012 TCTAGATCGGGGAGGAACAAAGG - Intronic
1028273888 7:88826962-88826984 ATGACATCTGGTAGGAATAATGG - Intronic
1028301323 7:89205274-89205296 ATGAGATTTGGGAGGAACCAGGG - Intronic
1028452043 7:90996057-90996079 AGTATCTCTGTGAGAAACAAAGG - Intronic
1028648998 7:93129449-93129471 ATTATTTCTGGGGGCATCAAAGG + Intergenic
1029336376 7:99903418-99903440 ATTGTTTCTGGGAGGAGGAATGG - Intronic
1030974710 7:116107242-116107264 ATTATAATTGGGAGGCAAAAGGG - Intronic
1031678017 7:124634786-124634808 ATGATATTTGGGAGGGACCAGGG + Intergenic
1032313191 7:130807881-130807903 ATTATATCAAGGAGGAAAATGGG - Intergenic
1033771042 7:144552148-144552170 ATTATATTTAGCAGGAAAAAAGG + Intronic
1035797809 8:2375657-2375679 ATTAAACCTGGGTGGAATAAGGG + Intergenic
1036022512 8:4861831-4861853 ATAATATGTGTGAGAAACAATGG + Intronic
1036133379 8:6136762-6136784 ATTACATGTGGAGGGAACAATGG + Intergenic
1041011472 8:53547864-53547886 ATTATATCTGGGATCAACATTGG + Intergenic
1042997176 8:74713934-74713956 CTTATATCTGGGAGAAAAGATGG + Intronic
1045597466 8:103672761-103672783 ATGAGATTTGGGAGGGACAAGGG - Intronic
1046352865 8:113038968-113038990 ATTATATCTGGGCTGAAATATGG - Intronic
1046854033 8:119008799-119008821 ATTTTATATGGGAGGAACAGCGG - Intronic
1048915959 8:139182812-139182834 ATGAGATTTGGGAGGAACCAGGG + Intergenic
1049878207 8:145041651-145041673 ATACTATCTGGGAGGCCCAAGGG - Intergenic
1049960391 9:732640-732662 ATTAAATGTGGGAGGGGCAAGGG - Intronic
1050072644 9:1832592-1832614 ATTACAGCTAGGAGGAACACAGG - Intergenic
1050950427 9:11584384-11584406 ATTTTACCTGGGAGGAGCACAGG + Intergenic
1052237887 9:26234860-26234882 AGCATATCTGGGAAGAATAAGGG - Intergenic
1052244364 9:26316024-26316046 GTTATCTCTGGGAAGAAGAATGG + Intergenic
1052337488 9:27335263-27335285 GTTATAGCTGGGAGGAAACATGG + Intronic
1056270704 9:84945635-84945657 ATTAAATCTGGGTGGCACAGGGG + Intronic
1057730694 9:97605680-97605702 AACATACCTGGTAGGAACAAAGG + Intronic
1058621168 9:106884637-106884659 AATATATTTGGCAGAAACAAAGG + Intronic
1059082331 9:111263534-111263556 AAGATATCTGAAAGGAACAAAGG - Intergenic
1059565322 9:115378572-115378594 ATGAAATCTGGGAGAAAAAAAGG + Intronic
1059999517 9:119945459-119945481 ATGATGGCTGGGAGGAACAAGGG + Intergenic
1061593572 9:131614275-131614297 ATGGCATCAGGGAGGAACAAAGG + Intronic
1186588328 X:10900896-10900918 CTTTTATGTGGCAGGAACAAAGG + Intergenic
1187204929 X:17172636-17172658 ATTAAATCTGGGAGCAATGATGG + Intergenic
1188055937 X:25541377-25541399 ATGAGATTTGGGAGGAACCAGGG - Intergenic
1188127215 X:26383940-26383962 ATGAGATCTGGGAGGGACCAGGG + Intergenic
1188675165 X:32930620-32930642 ATAGTATCTGGGAAGGACAATGG - Intronic
1189321227 X:40088843-40088865 ATTATTTCAGGGGGGAACCACGG - Intronic
1189839332 X:45056533-45056555 ATTACAACTGGGAGGGACCAGGG + Intronic
1190755646 X:53399538-53399560 CTAATAACTGGGAGGAAAAATGG - Intronic
1191662711 X:63667533-63667555 ATTATTTCTGGGAGGTATAAAGG - Intronic
1192060094 X:67816069-67816091 ATTATATCAGGAAGCAAAAATGG + Intergenic
1192580244 X:72275244-72275266 ATTAGAACTGGGAGGCACATGGG - Intronic
1192938448 X:75886377-75886399 CTTATTTCTGGAAGGAAAAAAGG - Intergenic
1194171650 X:90592423-90592445 AAAATATCTGGCAAGAACAATGG + Intergenic
1194785489 X:98078965-98078987 CCTCTATGTGGGAGGAACAAAGG - Intergenic
1195195113 X:102489885-102489907 ATGACATTTGGGAGGAACCAGGG - Intergenic
1195536413 X:106013517-106013539 ATGAGATTTGGGAGGAACCAGGG + Intergenic
1195643158 X:107199829-107199851 TTTATATCTTGGTAGAACAAGGG - Intronic
1195822200 X:108957276-108957298 ATGAGATTTGGGAGGGACAAGGG + Intergenic
1198144312 X:133839596-133839618 TTTATAACTGGGGAGAACAAAGG - Intronic
1198629148 X:138616060-138616082 ATGAGATTTGGGAGGAACTAGGG - Intergenic
1199279060 X:145977971-145977993 ATTAGATATGGGAGGCACCAGGG + Intergenic
1200517881 Y:4170173-4170195 AAAATATCTGGCAAGAACAATGG + Intergenic