ID: 986622548

View in Genome Browser
Species Human (GRCh38)
Location 5:9691005-9691027
Sequence TGGGCGTCTCTGCACTGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986622547_986622548 -8 Left 986622547 5:9690990-9691012 CCGGGGAGATAAACGTGGGCGTC 0: 1
1: 0
2: 0
3: 7
4: 45
Right 986622548 5:9691005-9691027 TGGGCGTCTCTGCACTGTCATGG 0: 1
1: 0
2: 4
3: 32
4: 136
986622546_986622548 -7 Left 986622546 5:9690989-9691011 CCCGGGGAGATAAACGTGGGCGT 0: 1
1: 0
2: 0
3: 2
4: 35
Right 986622548 5:9691005-9691027 TGGGCGTCTCTGCACTGTCATGG 0: 1
1: 0
2: 4
3: 32
4: 136
986622539_986622548 22 Left 986622539 5:9690960-9690982 CCAGGCCTCACTCGACAAAGTGT 0: 1
1: 0
2: 0
3: 6
4: 50
Right 986622548 5:9691005-9691027 TGGGCGTCTCTGCACTGTCATGG 0: 1
1: 0
2: 4
3: 32
4: 136
986622540_986622548 17 Left 986622540 5:9690965-9690987 CCTCACTCGACAAAGTGTGCGTA 0: 1
1: 0
2: 0
3: 0
4: 24
Right 986622548 5:9691005-9691027 TGGGCGTCTCTGCACTGTCATGG 0: 1
1: 0
2: 4
3: 32
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986622548 Original CRISPR TGGGCGTCTCTGCACTGTCA TGG Intronic
905021451 1:34817073-34817095 TGGCTTTCTCTGCACTGACAGGG - Intronic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
910208027 1:84766861-84766883 TGGGCATCTCTACACTCTCTTGG - Intergenic
910289658 1:85588092-85588114 TGGGCATCTCTGCTGTGACAGGG - Intergenic
910655062 1:89610446-89610468 CGGGCATCTCTGCACTCTCAGGG - Intergenic
911288765 1:96029157-96029179 CAGGCATCTCTGCACTCTCAAGG - Intergenic
912501986 1:110128863-110128885 TGGGCATCTCTGCAACCTCAGGG - Intergenic
914392832 1:147237277-147237299 TGGGCATCTCTGCACTCTTGGGG - Intronic
920048031 1:203146142-203146164 TGGGCATCTCCTCAGTGTCAGGG + Intronic
920048045 1:203146186-203146208 TGGGCATCTCCTCAATGTCAGGG + Intronic
921167438 1:212517114-212517136 TGTTCGTCTCTGTACTGTCATGG + Intergenic
921368664 1:214399641-214399663 TGGGAGTTTCTGCACTGAAAGGG - Intronic
924107228 1:240661193-240661215 TGGGCTTCTCTGGAGTGTTAGGG - Intergenic
1063764826 10:9126967-9126989 TGGGGCTCTCTGCTCTGGCAGGG + Intergenic
1065830238 10:29608510-29608532 TGGGCATCCCTGCACTCTCCAGG + Intronic
1065976462 10:30846766-30846788 CAGGCATCTCTGCACTCTCAGGG + Intronic
1067170705 10:43903834-43903856 TCACAGTCTCTGCACTGTCAGGG - Intergenic
1072914342 10:99527750-99527772 TGGGCGTCCCTGCAGCTTCAGGG + Intergenic
1075490323 10:122862034-122862056 TGGGCATGTCTGCACAGTAAGGG - Intronic
1077135342 11:995391-995413 TGTTCCCCTCTGCACTGTCAGGG + Intronic
1081284106 11:41246449-41246471 GGGGCATCTCTGCACTCTCAGGG - Intronic
1087131301 11:94671626-94671648 TGGGCATCTCTGTGCTCTCAGGG + Intergenic
1087205256 11:95387370-95387392 TGGGAGTCTCTGCTCTTTCCAGG + Intergenic
1088457332 11:110046878-110046900 GTGGAGTCGCTGCACTGTCAGGG - Intergenic
1089683750 11:120133935-120133957 TGGGGGGCCCTGCACTGTCATGG - Intronic
1095749785 12:45697353-45697375 TGGGCATCCCTGCACTCTCAGGG - Intergenic
1097492077 12:60282869-60282891 TGGGCATCTCTGCATTTTCATGG - Intergenic
1097536222 12:60873341-60873363 CGGGCATCTCTGCATTCTCAGGG - Intergenic
1098519721 12:71421345-71421367 TGGTCATCTCTGAACTCTCAGGG - Intronic
1098803100 12:74986053-74986075 CAGGCATCTCTGCACTCTCAGGG - Intergenic
1098951497 12:76644962-76644984 CAGGCATCTCTGCACTCTCAGGG + Intergenic
1101000615 12:100353882-100353904 TGGGACTCACTGCACTGTAATGG + Intergenic
1102349833 12:112184279-112184301 AGGCCGTCTCTGCATTGTCCAGG + Exonic
1103903154 12:124314055-124314077 TGGGCTGCTCTGAAATGTCAAGG - Intronic
1104640504 12:130463987-130464009 TTGGCGTCTGTAAACTGTCATGG - Intronic
1104718922 12:131033875-131033897 TGAGCGTCTGTGCATTTTCACGG + Intronic
1106838378 13:33660524-33660546 TGGTTCTCTCTGTACTGTCAGGG + Intergenic
1109438831 13:62343144-62343166 CAGGCATCTCTGCACTCTCAGGG + Intergenic
1109683622 13:65784518-65784540 TGAGCATCCCTGCACTCTCAGGG - Intergenic
1110777896 13:79432086-79432108 TGGGCATCTCTGCACTCTCGGGG + Intergenic
1111354537 13:87080580-87080602 TGGGCATCCCTGCGCTCTCAGGG - Intergenic
1111595282 13:90403619-90403641 TGGGCATCCCTGTACTCTCAGGG + Intergenic
1116317075 14:43410731-43410753 TGGGCATCCCTGTACTCTCAGGG - Intergenic
1117288580 14:54310634-54310656 TGGGCTGCTCTCCACTGCCAGGG + Intergenic
1117930780 14:60838737-60838759 TGGGCATCCCTGCACTCTCGGGG + Intronic
1118466318 14:66034428-66034450 TGGGAGGCTCTGCAGAGTCAGGG + Intergenic
1124820753 15:33043929-33043951 TGGGCATCTCTGCACTCTCAGGG + Intronic
1126112689 15:45184989-45185011 TGGGCCTCTCGGTACTGTCGAGG + Intronic
1129738945 15:77980542-77980564 TGGGCCTCCCTCCACTGTAATGG - Intergenic
1133705324 16:8349212-8349234 TGGGGTTCTCTTCTCTGTCAAGG - Intergenic
1136678692 16:31939792-31939814 TGTGTGTCTCTGCAGTGTGATGG - Intergenic
1137692814 16:50441245-50441267 TGGTCATATCTGCACTCTCAGGG + Intergenic
1137892016 16:52172890-52172912 TGGGTGTCTCTCCTCTCTCATGG - Intergenic
1139015402 16:62683947-62683969 TGGGTATCCCTGCACTTTCATGG + Intergenic
1139183030 16:64770295-64770317 CAGGCATCTCTGCACTCTCAGGG + Intergenic
1139230846 16:65281140-65281162 TGGGCCTCTGTGCACTGTCTGGG - Intergenic
1140890340 16:79279517-79279539 TGGGCATCTCTGTTCTGTCCTGG - Intergenic
1141034828 16:80618009-80618031 TGGGCCTCTCTGTGCTGTCAGGG + Intronic
1144556302 17:16285829-16285851 GGGGTGTCTCTGCACCGCCAAGG - Intronic
1145924642 17:28637114-28637136 TGGACGTCTCTGCACTGCCCAGG + Exonic
1146729235 17:35180181-35180203 TGGGCTTTTCTGCTCTCTCATGG + Intronic
1149330658 17:55577769-55577791 CGGGCATCTCTGCACTGTCGGGG - Intergenic
1149703264 17:58673089-58673111 TGGGAGTGGCTCCACTGTCATGG - Intronic
1150824446 17:68462342-68462364 TGAACCTCTCTGCACTGGCATGG - Intergenic
1152332681 17:79682211-79682233 AGGGCGTCTCTGCTATGTCTGGG - Intergenic
1153472987 18:5467930-5467952 TGGGCATCCCTGCACTCTCAGGG + Intronic
1153723886 18:7936302-7936324 TGGGCATCTTTGCACTCTCAGGG + Intronic
1154112163 18:11579470-11579492 TGGGCCCCTCTGCACTGTTAGGG - Intergenic
1154390538 18:13932800-13932822 TGTGTGTGTCTACACTGTCAGGG + Intergenic
1157441911 18:47718123-47718145 TGGGCTCCTCTGCACTTTCGTGG - Intergenic
1158779327 18:60627897-60627919 TGGGCCTTTGTGCAATGTCAAGG - Intergenic
1161851464 19:6739941-6739963 TGGGAGTCTCAGCACGCTCAGGG + Intronic
1162799991 19:13104985-13105007 TGGAGGTCTCTGGACAGTCAGGG + Exonic
1164884819 19:31769664-31769686 TGGGCTGCCCTGCACTGCCAAGG + Intergenic
1167101002 19:47404307-47404329 TGGGCGACTCAGCTCTTTCATGG - Intronic
925515209 2:4674328-4674350 TGGGCATCTCTGCACTCTCGGGG + Intergenic
927743302 2:25591218-25591240 CAGGCATCTCTGCACTGTCAGGG - Intronic
927974110 2:27324995-27325017 TTGGCTTCTTTGCACTGACATGG + Intronic
929847247 2:45542366-45542388 TGGGCATCCCTGCACTCTCAGGG - Intronic
930611909 2:53553818-53553840 CAGGCATCTCTGCACTCTCAGGG + Intronic
930957167 2:57217073-57217095 TGGGCATCTCTGCACTCTTGGGG + Intergenic
931300372 2:60973327-60973349 TAAGCATCTCTGCACTTTCAGGG + Intronic
934696628 2:96404930-96404952 TGGGCATCTCTGCACTCTTGGGG - Intergenic
937083653 2:119157368-119157390 TGGGGGTCTCTGGGCTCTCAAGG + Intronic
938068030 2:128292388-128292410 TGGGCGTCCCTGCCCTGAGAAGG - Intronic
938862414 2:135383098-135383120 TGTGAGTCTCTGCACTGAGATGG - Intronic
939807426 2:146790661-146790683 TGTGTGTCTCTGCACTGGGATGG - Intergenic
940711288 2:157165683-157165705 TGGGCATCCCTGCAATTTCAGGG - Intergenic
941657640 2:168161029-168161051 TACGCGTCTCTGCAATGACAGGG + Intronic
943179535 2:184525058-184525080 TGGGCATCTCTGCACTCAGAAGG - Intergenic
943427089 2:187750358-187750380 TAGGCATCTCTGCACTCTCGGGG - Intergenic
943928570 2:193820060-193820082 TGGGTATCTCTGCATTTTCAGGG - Intergenic
947377117 2:229507529-229507551 TCAGCATTTCTGCACTGTCATGG - Intronic
947477799 2:230466858-230466880 TGGGCATCTCTGCTTTGTCTTGG - Intronic
948271656 2:236678514-236678536 TGGGGGTCACTGCTCTGCCAGGG - Intergenic
948542108 2:238698567-238698589 TGGTCGCGTCTGTACTGTCATGG + Intergenic
948712899 2:239836315-239836337 CAGGCATCTCTGCACTCTCAGGG + Intergenic
1169309249 20:4521375-4521397 TGGGCATCCCTCCACTCTCAGGG + Intergenic
1175221886 20:57421933-57421955 CGGGCGGCTGGGCACTGTCATGG - Intergenic
1177262413 21:18748472-18748494 TGGGTATCTCTGTACTCTCAGGG - Intergenic
1177286915 21:19063554-19063576 TTTGCGTGTCTGCACAGTCATGG + Intergenic
1177357906 21:20032059-20032081 CAGGCATCTCTGCACTCTCAGGG - Intergenic
1178947279 21:36959111-36959133 TGGGCATCCCTGCACTCTCAGGG + Intronic
1184915231 22:47564291-47564313 TGTGCGTCTCTGCACATGCAGGG + Intergenic
953801943 3:46031257-46031279 CAGGCATCTCTGCACTGTCGGGG + Intergenic
953916318 3:46923223-46923245 TGCCAGTCTCTGCACTGTGACGG + Intronic
954431244 3:50471977-50471999 TGTGCTTCTCTGGACAGTCATGG - Intronic
957459480 3:80497832-80497854 TGAGCATCCCTTCACTGTCAGGG - Intergenic
957550248 3:81694940-81694962 TTGGCGACTGTGAACTGTCATGG - Intronic
957636254 3:82790317-82790339 TGGGCATCTCTGCACTCTCAGGG + Intergenic
964927366 3:161975368-161975390 TGGGCATCCCTGCACTTTCAGGG - Intergenic
965074063 3:163953825-163953847 CAGGCATCTCTGCACTTTCAGGG - Intergenic
965367668 3:167820389-167820411 TGGGCATCTCTGCACTCTCCAGG + Intronic
967112338 3:186304958-186304980 TGGGCTTCTATGCACTGTACTGG - Intronic
968530935 4:1091257-1091279 TGGGCCTGTCTGCACTCCCAGGG + Intronic
968591442 4:1461684-1461706 TGGGCCACTCTGCCCTGTCTGGG - Intergenic
968910131 4:3473312-3473334 CCCGGGTCTCTGCACTGTCACGG + Intronic
971283226 4:25259858-25259880 TGTGGGTCCCTGGACTGTCAGGG + Intronic
976097908 4:81528478-81528500 CAGGCATCTCTGCACTCTCAAGG - Intronic
976647254 4:87399511-87399533 CGGGCATCTCTGCACTCTCAGGG + Intergenic
977358987 4:95980661-95980683 TGGGTCTCTCTGCACTCTTAGGG + Intergenic
978149457 4:105415567-105415589 TGGGCATCCCTGCACTCTCGGGG - Intronic
978248668 4:106604725-106604747 TGGGCATCTCTGCACTCTTGAGG - Intergenic
978498382 4:109384210-109384232 TGGGCATCTCTGTACTGTTGGGG + Intergenic
980450049 4:132958842-132958864 TAGGCATCTCTGCACTCTCAGGG + Intergenic
980480830 4:133385286-133385308 CGGGCATCCCTGCACTCTCAGGG + Intergenic
980574458 4:134666787-134666809 TGGGCATCTCTGCACTCTTGGGG - Intergenic
980731030 4:136824284-136824306 CAGGCATCTCTGCACTCTCAGGG - Intergenic
980744883 4:137000727-137000749 TGGGCATCTCTGCACTCTCAAGG + Intergenic
982976943 4:162075739-162075761 TGGGTGTCTCTTCACTGCCTTGG - Intronic
983949820 4:173627142-173627164 TGGGCCCCTCGGCAGTGTCATGG + Intergenic
986622548 5:9691005-9691027 TGGGCGTCTCTGCACTGTCATGG + Intronic
988218540 5:28310989-28311011 TGGGCATCCCTGCATTCTCAGGG + Intergenic
989730555 5:44642273-44642295 TGGGCATCCCTGCACTCTCAGGG - Intergenic
990799800 5:59587704-59587726 TGCGCGGCTCTGCAATGTCTGGG - Intronic
991642925 5:68772461-68772483 TGGGTGTCTCAACAATGTCAAGG + Intergenic
992839015 5:80668701-80668723 CGGGCATCTCTGCAATCTCAAGG - Intronic
993211941 5:84962420-84962442 TGGGCCTCCCTGCACTCTCAGGG - Intergenic
993703445 5:91144096-91144118 TGGGCATCTCTGCACTCTCAAGG - Intronic
998480621 5:142459674-142459696 TGGGCATCTCTGCACTTTTGGGG - Intergenic
1011547601 6:88498591-88498613 TGGGGGTTTATGCACTGCCAAGG + Intergenic
1011822711 6:91271890-91271912 TGGGCATCCCTACACTTTCAGGG - Intergenic
1012122288 6:95384043-95384065 TGGGCATCTCTACACTCTCAGGG + Intergenic
1012530394 6:100228975-100228997 TTGGCGTCTCGGAACTGACAGGG + Intergenic
1016758952 6:147716416-147716438 CAGGCATCTCTGCACTCTCAGGG - Intronic
1017785966 6:157757543-157757565 TGGGTGACTCTTCTCTGTCATGG - Intronic
1019051639 6:169188182-169188204 GGGGCGTCTCTGGACACTCACGG + Intergenic
1019508982 7:1407795-1407817 TGGGCTTCTCTCCAATGCCAGGG + Intergenic
1021403395 7:20236370-20236392 TTGGGGTCTGTGCACTGTCTGGG + Intergenic
1028527503 7:91801766-91801788 TGGGCATCTCTGCACTCTCGGGG - Intronic
1031859005 7:126957458-126957480 TGGGCATCCCTGCTCTCTCAGGG + Intronic
1032658417 7:133955963-133955985 TGGGCATCTCTGGACTCTCAGGG - Intronic
1034210500 7:149358583-149358605 TAGGCATCTCTGCACTCTCAGGG - Intergenic
1035392676 7:158515834-158515856 TGGTCGTCTCTCCACAGCCATGG + Intronic
1036430279 8:8683368-8683390 TGGGCTTCTCTGTAATGACATGG - Intergenic
1038159487 8:25023153-25023175 TTGGCATCTCTGTGCTGTCAGGG + Intergenic
1042624998 8:70748305-70748327 TGGGCATCCCTGCACTCGCAGGG + Intronic
1042856522 8:73273269-73273291 TGGGCATCCCTGCACTCTCAGGG + Intergenic
1046503842 8:115111905-115111927 TGGGCATCTCTGCAATCTCGAGG - Intergenic
1046674770 8:117095071-117095093 TGGGCATCTCTGCACTCTTAGGG - Intronic
1047544040 8:125797914-125797936 TGGGCATCTCTGCACTCTTGGGG - Intergenic
1049453917 8:142677422-142677444 TGGGTGACTCTGCACCGCCAGGG - Intronic
1050941882 9:11471234-11471256 TGGGCATCCCTGCACTCTCAGGG + Intergenic
1062086911 9:134653767-134653789 TGGGGGTGTCTGCAGGGTCAGGG + Intronic
1190360656 X:49645351-49645373 TGGGCATATCTGCACTCTCAGGG - Intergenic
1191016254 X:55813395-55813417 TGGGTATCCCTGCACTCTCAGGG + Intergenic
1192267113 X:69546620-69546642 TGGGCGTGTCTTCACTCTCGAGG + Intergenic
1194655688 X:96570531-96570553 TGGGCATCCCAGCACTGTCCAGG + Intergenic
1194708132 X:97200519-97200541 TGTCAGTCTCAGCACTGTCAGGG - Intronic
1195709302 X:107761251-107761273 TGGGCTTCTCTGCCCTCACAAGG - Intronic
1196183990 X:112725922-112725944 TGGGAATTTCTGCAGTGTCAAGG - Intergenic
1197609639 X:128623652-128623674 TGGGCATCTCTGCACTCTTGGGG - Intergenic
1200475230 Y:3634048-3634070 TGGGGGTCACTGCAAGGTCAGGG + Intergenic