ID: 986623404 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:9700564-9700586 |
| Sequence | GCATGATCACTCAGGAGCGT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 51 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 45} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 986623402_986623404 | 4 | Left | 986623402 | 5:9700537-9700559 | CCTTTCTCAGGAACTCAAATCTA | 0: 1 1: 0 2: 0 3: 14 4: 209 |
||
| Right | 986623404 | 5:9700564-9700586 | GCATGATCACTCAGGAGCGTTGG | 0: 1 1: 0 2: 0 3: 5 4: 45 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 986623404 | Original CRISPR | GCATGATCACTCAGGAGCGT TGG | Intronic | ||