ID: 986623404

View in Genome Browser
Species Human (GRCh38)
Location 5:9700564-9700586
Sequence GCATGATCACTCAGGAGCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 45}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986623402_986623404 4 Left 986623402 5:9700537-9700559 CCTTTCTCAGGAACTCAAATCTA 0: 1
1: 0
2: 0
3: 14
4: 209
Right 986623404 5:9700564-9700586 GCATGATCACTCAGGAGCGTTGG 0: 1
1: 0
2: 0
3: 5
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986623404 Original CRISPR GCATGATCACTCAGGAGCGT TGG Intronic