ID: 986623959

View in Genome Browser
Species Human (GRCh38)
Location 5:9706300-9706322
Sequence CAGAACCAGGGGAACTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986623950_986623959 15 Left 986623950 5:9706262-9706284 CCAGTGGGGAAGGGAGGAAGTAG 0: 2
1: 0
2: 2
3: 47
4: 425
Right 986623959 5:9706300-9706322 CAGAACCAGGGGAACTGGCCTGG 0: 1
1: 0
2: 0
3: 25
4: 248
986623952_986623959 -10 Left 986623952 5:9706287-9706309 CCCTGGCCATACTCAGAACCAGG 0: 1
1: 0
2: 1
3: 20
4: 160
Right 986623959 5:9706300-9706322 CAGAACCAGGGGAACTGGCCTGG 0: 1
1: 0
2: 0
3: 25
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986623959 Original CRISPR CAGAACCAGGGGAACTGGCC TGG Intronic
901867463 1:12116503-12116525 CAAAACCAAGGGGAATGGCCAGG + Intronic
903275997 1:22222242-22222264 CATAACCAGGGAAGCTGGCCGGG + Intergenic
904260941 1:29287267-29287289 CACAGCCAGGGGATCTGACCTGG - Intronic
904466937 1:30713874-30713896 CTGAGCCAGGGGAACTGTCTGGG + Intronic
905195012 1:36269221-36269243 CAGAACCAGTGGAACCAGCCTGG - Intronic
905850655 1:41272158-41272180 CAGAAGCAGGGGAAGCAGCCAGG - Intergenic
907363917 1:53944929-53944951 CAGAACCAAGGGAGCTGGTCAGG - Intronic
907464301 1:54624731-54624753 CTGATCCAGGGAAACTGTCCTGG - Intronic
909207970 1:72784334-72784356 ATGAAGCAGGGGAACTGGACAGG + Intergenic
912580508 1:110717035-110717057 CAGAAACAGGAGACCTTGCCAGG - Intergenic
915071460 1:153272446-153272468 TAGAGCCACAGGAACTGGCCTGG + Intergenic
915509164 1:156377209-156377231 GAGAGCCAGGGGCACTGGCAGGG + Intronic
915692174 1:157700481-157700503 CAGAAGCATGGGCACCGGCCGGG + Exonic
916117186 1:161496023-161496045 CAGAACCTAGGAAAGTGGCCTGG + Intergenic
918431092 1:184461489-184461511 CAGAACCAGAGCCACTGGCCAGG + Intronic
920311065 1:205048530-205048552 CTGCACCAGGGCAGCTGGCCTGG + Intronic
920857534 1:209675310-209675332 CAGAGCCAGGGGAACTCGGAGGG - Intergenic
921052386 1:211520133-211520155 AAGAACAAGGGGAATTGGCTGGG + Intergenic
921586132 1:216948259-216948281 AAGAAATAGGGGACCTGGCCAGG + Intronic
922096926 1:222450575-222450597 AAGAAGCAGGGGACCTGTCCCGG + Intergenic
922338206 1:224634758-224634780 CAGATGCAGGGTAACTGGGCAGG - Intronic
923234881 1:232022599-232022621 CAGAACCATGGGTATTGGCTGGG - Intronic
1067495553 10:46757314-46757336 AAGAGCCAGGGGACCTGGCCTGG + Intergenic
1067599100 10:47583074-47583096 AAGAGCCAGGGGACCTGGCCTGG - Intergenic
1067948763 10:50709659-50709681 AAGAGCCAGGAGACCTGGCCTGG - Intergenic
1069205940 10:65685839-65685861 CAGCACCAGGGGAAAAGGCAGGG - Intergenic
1069566155 10:69464778-69464800 CAGAACCAGGGGCACATGCTGGG - Intronic
1069729149 10:70599999-70600021 CAGAGGCAGGAGACCTGGCCGGG - Intronic
1070304704 10:75233482-75233504 CAGGTCCAGGCCAACTGGCCTGG + Intergenic
1070884081 10:79874652-79874674 AAGAGCCAGGGGACCTGGCCTGG - Intergenic
1071571478 10:86699702-86699724 CAGAACCAAGGGAAATGGATGGG + Intronic
1071650635 10:87390952-87390974 AAGAGCCAGGGGACCTGGCCTGG - Intergenic
1073875446 10:107916394-107916416 CAGCAGCAGGGGACCTGGCTTGG - Intergenic
1074526203 10:114265515-114265537 AAGAAACAGGGGCCCTGGCCAGG + Intronic
1075616391 10:123893231-123893253 CAGACCCAGAGGAACTGGGAAGG - Intronic
1077371007 11:2181673-2181695 CAGAATCTGGGGAACTTGCAAGG - Intergenic
1077404130 11:2375243-2375265 CAGAGCCAGGGGAAAGGGGCTGG - Intergenic
1078142078 11:8700044-8700066 CAGCCCCACGGGAGCTGGCCTGG + Intronic
1081706006 11:45182158-45182180 CAAAAGCTGGGGACCTGGCCAGG - Intronic
1083307566 11:61769233-61769255 GAGAGCCAGGGGAAGGGGCCGGG - Intronic
1084417651 11:69042749-69042771 TAGAACCAGGGATGCTGGCCAGG - Intergenic
1087661810 11:100997283-100997305 CAGAAGCTGTGGACCTGGCCGGG - Intergenic
1088804459 11:113339411-113339433 TAGAACAAGGGGATCTGGTCAGG - Exonic
1088850902 11:113702675-113702697 CAGAACAGGGGGTCCTGGCCTGG - Intronic
1088999247 11:115036594-115036616 CTGAAAGAGGGGAACTGGCAGGG + Intergenic
1089080877 11:115775339-115775361 CAGAGCCAGGGGAGGTGGCGAGG + Intergenic
1090414373 11:126530570-126530592 GAGGAGCAGGGGAACAGGCCTGG + Intronic
1099207800 12:79748169-79748191 AAGAAGCAAGGAAACTGGCCAGG - Intergenic
1100779999 12:98013824-98013846 TAGAACCACAGGGACTGGCCTGG - Intergenic
1102027766 12:109723310-109723332 CATCCCCAGGGAAACTGGCCTGG - Intronic
1102467465 12:113138199-113138221 CAGAACAACAGGAAATGGCCGGG - Intergenic
1102757441 12:115354424-115354446 AAAAACCAGGGGAACTGGGTGGG - Intergenic
1103401323 12:120645098-120645120 CTCAACCACAGGAACTGGCCGGG - Intronic
1103994674 12:124821396-124821418 CAGAACCAGGCCAAGCGGCCAGG - Intronic
1104907340 12:132220609-132220631 CAGAACCAGGGGAATTTCCAGGG + Intronic
1107104171 13:36625834-36625856 CATATCCAGGGGAAATGGCAGGG + Intergenic
1108817165 13:54305758-54305780 CAGAACCAGGTAGACTTGCCAGG + Intergenic
1109104975 13:58239411-58239433 CAGAAGCAGGACAGCTGGCCTGG - Intergenic
1110092069 13:71464864-71464886 CAGAAACAGGGAAACTGGAAGGG + Intronic
1114139444 14:19894213-19894235 CAGACCCTGGGGAAATGGTCAGG + Intergenic
1117642401 14:57813754-57813776 CAGAACAATGGGCACTGGCCTGG + Intronic
1118236405 14:64008928-64008950 CAGAATCAGGGGAAACTGCCAGG - Intronic
1118493320 14:66283177-66283199 CAGAGGCAGGAGAATTGGCCAGG - Intergenic
1118671420 14:68132143-68132165 CAAAACTAGGGGATCTGGCTTGG + Intronic
1121866673 14:97368377-97368399 CAGGACCAGGTGGAATGGCCCGG + Intergenic
1122210536 14:100170940-100170962 CTGCTCCAGGGGCACTGGCCTGG + Intergenic
1122644495 14:103184651-103184673 CAGAACTAGGTGAACTTGGCCGG + Intergenic
1123712843 15:23002491-23002513 CTGAATCAGGGGAAGTGGCCCGG - Intronic
1124387574 15:29223296-29223318 CAGAACCAGGAGGACTTGTCTGG - Intronic
1125059116 15:35397780-35397802 GATAAACAGAGGAACTGGCCTGG + Intronic
1125313920 15:38410723-38410745 CAGAAGCAGGGGAAATGGTGAGG + Intergenic
1126151200 15:45525088-45525110 CAAAACCTGGGTGACTGGCCGGG - Intergenic
1128761390 15:70218350-70218372 CAGAGCCAGGAGTACTGGACAGG - Intergenic
1129264667 15:74387291-74387313 CAGTAGCAGGGCAGCTGGCCAGG + Intergenic
1131551048 15:93357304-93357326 AAGATCCAAGGGAAGTGGCCTGG + Intergenic
1132227208 15:100151641-100151663 CAGAAGTAGGGGAACCAGCCAGG - Intronic
1132672348 16:1106994-1107016 CAGAACCGGCGGCAGTGGCCTGG + Intergenic
1132698315 16:1211685-1211707 CAGAGCCAGGGTCACTGGCGAGG - Intronic
1132907556 16:2290719-2290741 CAGACCCAGGGAAAAAGGCCAGG - Intronic
1133066049 16:3207877-3207899 CTGAACTGTGGGAACTGGCCAGG + Intergenic
1136228597 16:28874301-28874323 CAGAATGATGGGGACTGGCCTGG - Intergenic
1136501193 16:30670313-30670335 CAGGACCTGGGGACCTGGGCTGG + Exonic
1138827969 16:60343766-60343788 CAAACCCAGAGGAACTGGCATGG + Intergenic
1140409298 16:74732177-74732199 AAAAACCAGGGGCGCTGGCCAGG - Intronic
1140827083 16:78716583-78716605 CAGAACCACACGAACTTGCCTGG - Intronic
1140914871 16:79484199-79484221 CAGAACCAAGGCAACCGTCCAGG + Intergenic
1141161244 16:81630518-81630540 CAGAGCCAGTGGCACTGACCCGG - Intronic
1203145056 16_KI270728v1_random:1793824-1793846 CAGAACGAGGGGACCCAGCCTGG - Intergenic
1142505028 17:357831-357853 AAGAGCTAGGGGAACTGGGCAGG - Intronic
1143010915 17:3865787-3865809 CAGAGCCTGGGGACTTGGCCAGG - Exonic
1143329361 17:6122038-6122060 CAGGACCATGGGGCCTGGCCAGG - Exonic
1143995837 17:11005815-11005837 CAGCACCAGGGGTGCTGGCCAGG + Intergenic
1145842624 17:28008736-28008758 CAGAACCATGGGCAGAGGCCAGG - Intergenic
1146623771 17:34420534-34420556 CAGAGCCAGGGGTCCTTGCCTGG + Intergenic
1147450857 17:40502926-40502948 CAGCCCCAGGGGAGATGGCCAGG - Intergenic
1148883915 17:50757493-50757515 TAGAATCAGTGGAATTGGCCGGG + Intergenic
1148904674 17:50904775-50904797 CAGGACCAGGGGGCCTGGGCAGG + Intergenic
1150375406 17:64677242-64677264 CTGAGCCAGGAGAACTGGCAGGG - Intergenic
1151140151 17:71983961-71983983 CAGAGCCATGGGAACCTGCCAGG + Intergenic
1151882025 17:76901713-76901735 CAGAAGCCTGGGAACTTGCCAGG - Intronic
1152240650 17:79159204-79159226 CAGCACCAGGTGAGCTGACCTGG + Intronic
1152426075 17:80219575-80219597 CAGAAAGAGGGCAACTGGCAGGG + Intronic
1155655164 18:28184023-28184045 CAGTACAGGGTGAACTGGCCTGG - Intergenic
1157378110 18:47184701-47184723 CAGAACCAGTGGACCAGTCCAGG - Intergenic
1158973974 18:62693850-62693872 CAAAAGCAGGCAAACTGGCCAGG - Intergenic
1159960865 18:74555042-74555064 GAGAACAAGGGGAACTAGGCTGG - Intronic
1160161943 18:76479987-76480009 CAGAAACAGAGGAACCTGCCTGG + Intronic
1160736653 19:665755-665777 AAAAACCAGGGGAAAGGGCCGGG - Intergenic
1161842428 19:6690803-6690825 CAGAATCAGGGGGTCTGGGCAGG + Intronic
1162579658 19:11521089-11521111 CAAAAACAGTGGAATTGGCCGGG - Intronic
1163429414 19:17258180-17258202 TGGAACCCTGGGAACTGGCCTGG - Intronic
1163697338 19:18770484-18770506 GAGAGCCAGGGGACCTGCCCAGG + Intronic
1166211028 19:41306640-41306662 CAGCACCACGGGATCTGGCGGGG - Exonic
1167084542 19:47300257-47300279 CAGAACCAGCCAAACTGGGCTGG - Intronic
1167664469 19:50815880-50815902 AAGAACTAAGGGAACTGGCTGGG + Intergenic
1168139256 19:54374397-54374419 CAGAACTAAGGGAACTGGGAGGG - Intergenic
925085577 2:1105163-1105185 CTGAACCATGGGAGCAGGCCAGG + Intronic
925714595 2:6772641-6772663 CAGAACCAGGAGCCCGGGCCAGG - Intergenic
927811021 2:26180152-26180174 CAGAACAAGGGGAAATGACTAGG - Intronic
927842327 2:26453583-26453605 CAGAACCAGGGGAGCTGGATGGG + Intronic
928524514 2:32126098-32126120 CAAAAACAGAGGAACTGGCCGGG - Intronic
930873991 2:56193256-56193278 CAGAGCCAGGGGCACCAGCCCGG + Exonic
933523815 2:83410272-83410294 CAGCACCAGTGGACCTGCCCAGG - Intergenic
934732098 2:96665907-96665929 CAGAACCAATGGCACAGGCCAGG + Intergenic
936063456 2:109313170-109313192 AAGAACCAGGGGACCTGGAAAGG + Intronic
936958210 2:118044683-118044705 CAGAACCATGGGGACTGAACAGG + Intergenic
940517596 2:154699555-154699577 TAGAACCAGGGGAGGGGGCCCGG - Intronic
940792467 2:158043241-158043263 CAGCCTCAGGGGAGCTGGCCTGG + Intronic
945778564 2:214138225-214138247 CACAACAAGGGGACCTGGCTAGG + Intronic
946224946 2:218259496-218259518 CAGAACCACGGGATCTGGTCGGG - Intronic
946275735 2:218630329-218630351 CATAACCAGGGAATGTGGCCTGG + Intronic
946916501 2:224528401-224528423 CAGGCCCAGGGGAACAGCCCAGG + Intronic
947353384 2:229269812-229269834 GAGACCCTGGGGAACTGGTCTGG + Intronic
947769906 2:232662362-232662384 GAGAACCAGGGGCAGTGACCAGG + Intronic
1169557025 20:6762251-6762273 CAGAAGCTGGGGAGCTGGCGGGG - Intergenic
1172114700 20:32566765-32566787 CAGAACCAGGGGAACTCAAGGGG - Intronic
1173672658 20:44809584-44809606 CAGACGGAGGGGAACCGGCCAGG - Intronic
1173708648 20:45135565-45135587 CAGTGCATGGGGAACTGGCCTGG + Intergenic
1173826831 20:46053210-46053232 CAGACTCAGGGGCTCTGGCCAGG + Intronic
1173847355 20:46196597-46196619 CAGCACCAGGGAAACAGGACTGG + Intronic
1174890857 20:54390587-54390609 CAGAAGCAGGGGAAATGGCAGGG - Intergenic
1175193271 20:57225297-57225319 CAGAATTAGGGGAATTGGCTCGG + Intronic
1175689110 20:61052952-61052974 CAGAGGAAGGGGAATTGGCCCGG + Intergenic
1176046017 20:63092988-63093010 AAGAACCAGGCGAGCTGACCGGG - Intergenic
1178005494 21:28215389-28215411 CAGAACCAGGAGAACTGATATGG + Intergenic
1179281742 21:39939616-39939638 CAGCACCAGGAGAATTGGACAGG - Intergenic
1179534867 21:42045046-42045068 CAGAACCAGAGGAGCAGGTCGGG - Intergenic
1179604973 21:42509295-42509317 CAGCATCAGGGGAAGTGGCAAGG - Intronic
1179621622 21:42620095-42620117 CATAGTCATGGGAACTGGCCTGG - Intergenic
1180351801 22:11811857-11811879 CAAAACCTGGGGTACAGGCCGGG - Intergenic
1180784228 22:18537983-18538005 AAAAACCAGGGCACCTGGCCGGG - Intergenic
1181127795 22:20712035-20712057 AAAAACCAGGGCACCTGGCCGGG - Intronic
1181241129 22:21477335-21477357 AAAAACCAGGGCACCTGGCCGGG - Intergenic
1181618281 22:24070330-24070352 CACAACAGGGGCAACTGGCCAGG - Intronic
1183513248 22:38248180-38248202 CAGAAGCAGAGAAACTGGTCAGG - Intronic
1183622910 22:38985193-38985215 CAGAACTGTGGGAAGTGGCCAGG - Intronic
1183938719 22:41280261-41280283 CCCAACCAGGGGAACTGGTCTGG - Intronic
1183953419 22:41365262-41365284 CAGAGCAAAGGGCACTGGCCAGG + Intergenic
1184118919 22:42437934-42437956 CAGCACGAGGGGAAAGGGCCGGG - Intergenic
1184790004 22:46694560-46694582 CAGAGCCAGGGCAGCTGCCCAGG - Intronic
951427417 3:22563944-22563966 AAAAACCAGGGGAGTTGGCCGGG + Intergenic
953075519 3:39566519-39566541 GATACCCAGGGGAACTGGCATGG - Intergenic
954383692 3:50233238-50233260 CATAACCACAGGACCTGGCCTGG + Intronic
954633050 3:52057163-52057185 CAGGACCTGGGCAACTGGCGGGG + Intergenic
955079655 3:55647023-55647045 AAGAAGCAGGTGAACTGGGCAGG - Intronic
958883802 3:99703349-99703371 CAGAGCCAGGAGAACAGCCCTGG + Intronic
959043058 3:101441206-101441228 CAGAAGCATGAGTACTGGCCAGG + Intronic
959584011 3:108009081-108009103 CAGAGCCAGGGAACCAGGCCAGG + Intergenic
960568286 3:119158090-119158112 AAGAATCAGGGGAAGTAGCCTGG - Intronic
963011015 3:140770506-140770528 TTCAACCAGGGGAGCTGGCCAGG - Intergenic
965657033 3:170998302-170998324 ATGAACCAGGGGATCGGGCCTGG + Exonic
966750852 3:183320769-183320791 CACAACTAGGCGAACTGGCTAGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967053083 3:185802913-185802935 CAGAAATAGGATAACTGGCCGGG - Intronic
968569749 4:1333414-1333436 GAGAACCAGGGGGACAGGCAAGG - Intronic
969260043 4:6027623-6027645 CAGAGCAGGAGGAACTGGCCAGG - Intronic
973792945 4:54395039-54395061 CTCAAGCAGGGGAAGTGGCCTGG + Intergenic
979403044 4:120274413-120274435 GAAAACCAGGGTAATTGGCCTGG + Intergenic
979612847 4:122707675-122707697 CAGCACCTGTGCAACTGGCCTGG - Intergenic
980694329 4:136336640-136336662 CTGAACAAGGCCAACTGGCCTGG + Intergenic
984828531 4:183950408-183950430 CAGAAGAAGGGGACCTGGCCTGG + Intronic
986623959 5:9706300-9706322 CAGAACCAGGGGAACTGGCCTGG + Intronic
987345979 5:16979314-16979336 AAGAATTATGGGAACTGGCCAGG + Intergenic
988551342 5:32203728-32203750 CAGAAAATGGGAAACTGGCCGGG - Intergenic
989139460 5:38188873-38188895 CAGAACCAGGCCAGCTGACCAGG - Intergenic
989169059 5:38457404-38457426 CAGAACCTGGGGGACAGGCATGG - Intronic
990531622 5:56679739-56679761 CAGAACCTGGGGACCTGGAGAGG + Intergenic
997078840 5:130714661-130714683 CAGACCCAGTGGACCTGTCCTGG + Intergenic
1000154252 5:158535086-158535108 CAGAACCAGGGAAAAGGGGCAGG - Intergenic
1001509667 5:172311145-172311167 GAGAACCAGTGGAGCTGGGCTGG + Intergenic
1001933428 5:175688581-175688603 CAGAAACAGAGGAGCTGGCCTGG + Intergenic
1003516874 6:6825230-6825252 CAGACCCAGGGCATCTGGCAGGG - Intergenic
1005470255 6:26156334-26156356 CGGAAGCAGAGGCACTGGCCGGG - Intergenic
1006013172 6:31059307-31059329 CAGAGCCAGGGAAACAGGCTGGG + Intergenic
1006378852 6:33686245-33686267 GAGAACCAGGTGAGCTGTCCTGG + Exonic
1006379934 6:33691553-33691575 CAGAGCCAGGGGATAAGGCCAGG + Intronic
1006731614 6:36240280-36240302 CAGAAAGAGGAGGACTGGCCAGG - Intergenic
1012375568 6:98557947-98557969 CAGGCCCCGGGGCACTGGCCAGG + Intergenic
1013400999 6:109796069-109796091 AAGAGCCAGAGGAAATGGCCTGG - Intronic
1015111454 6:129596449-129596471 CAGAACAAGGGGAATTGGGAAGG - Intronic
1015835156 6:137412840-137412862 CAGAACCAGAGGAACACGGCAGG + Intergenic
1017207015 6:151813986-151814008 CAGAAGCCGTAGAACTGGCCGGG + Intronic
1017378362 6:153797542-153797564 CAGAGCCAGGGGTGGTGGCCTGG + Intergenic
1017413663 6:154196079-154196101 GTGAACCAGGGGGACTGGGCAGG - Intronic
1019083996 6:169457053-169457075 CAGAACCTAGGGAAGAGGCCAGG + Intergenic
1019509291 7:1409277-1409299 CAGAAACATGGAAAATGGCCAGG + Intergenic
1019698371 7:2460459-2460481 CGGAACCAGGGCCACGGGCCCGG - Intergenic
1020013354 7:4818010-4818032 CAGCACCTGGGGAAGGGGCCAGG + Intronic
1020534147 7:9372999-9373021 CAGAAACAGGGGAAGTGGGAGGG - Intergenic
1021455559 7:20826398-20826420 CAGAAACAGGGAAAGAGGCCTGG - Intergenic
1022007302 7:26277839-26277861 CAGAAACAGCTGAATTGGCCGGG - Intergenic
1023244142 7:38182497-38182519 ATGAACCAGGGGTACTGACCAGG - Intronic
1026351379 7:69518397-69518419 CAGACAAAGGGGAGCTGGCCAGG + Intergenic
1026869039 7:73839849-73839871 CAGACCCAGGCAAACAGGCCGGG - Intronic
1029371676 7:100154711-100154733 CAGAACCAGGGTAAAGGGCCGGG + Exonic
1029371816 7:100155236-100155258 CAGAACCAGGGGGCGTGGCATGG - Intronic
1031982276 7:128135762-128135784 CAGATCCAGGGGAGCAGGCGGGG - Intergenic
1032121726 7:129161891-129161913 GAAATCCAGGGGCACTGGCCTGG - Intronic
1035431602 7:158827530-158827552 GAGAACCAAGGTAACTGGCATGG - Intronic
1036492983 8:9244918-9244940 CAGCCCCAGGGAGACTGGCCCGG + Intergenic
1036619013 8:10410634-10410656 CAGAACCAGGAGAAGAGCCCAGG + Intronic
1036817531 8:11913204-11913226 CAGAAACAAGGGACCTGTCCAGG + Intergenic
1037826401 8:22163063-22163085 CAGAACCTGGGGAAAGGGCATGG - Exonic
1038279144 8:26147918-26147940 CAAAACCAGGGGCACTGGACAGG - Intergenic
1039889294 8:41673400-41673422 CAGAACCAGGGGTAGTAACCAGG + Intronic
1040946807 8:52893205-52893227 CAGGCCCAGCGGAACTGTCCTGG - Intergenic
1042039446 8:64577113-64577135 CAGAACCAGGGGCGCTGGGCTGG + Intergenic
1042569254 8:70144814-70144836 CACGACCAGGGCAACTGGGCAGG - Exonic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1044991294 8:97798528-97798550 AAGAACCAGGGCACCTGGACAGG + Intronic
1046135581 8:110022056-110022078 CAGAACCAGGGGAAAAGTCCTGG + Intergenic
1046943854 8:119956596-119956618 CAGAACCAGGGATAAAGGCCAGG + Intronic
1047300343 8:123608748-123608770 CAGACCCAGGGGCACAGGGCAGG - Intergenic
1047407032 8:124594233-124594255 CAGAAACAGATGAACTGGCCGGG + Intronic
1048111028 8:131469088-131469110 CAGAGCCATGAGAACTGGCTGGG + Intergenic
1049197489 8:141323764-141323786 CAGAGAAAGAGGAACTGGCCAGG + Intergenic
1049340456 8:142109566-142109588 CAGAACCAGGGCAAAGAGCCTGG + Intergenic
1049396085 8:142401609-142401631 CAGACTCAGGGGAAGTGTCCAGG + Intronic
1049852533 8:144840742-144840764 GAGAAGCAGGGGAGGTGGCCAGG + Intronic
1050199468 9:3128283-3128305 CATGACAAGGGGTACTGGCCTGG - Intergenic
1051243008 9:15080177-15080199 CACAACCTTGGGAAATGGCCTGG + Intergenic
1051253872 9:15191722-15191744 CATAACCAGGTGCACTGCCCAGG - Intronic
1051362754 9:16295270-16295292 CAGAACCAGGTAGACTGGCTGGG + Intergenic
1051522363 9:18003434-18003456 CAGCATCATTGGAACTGGCCGGG - Intergenic
1051635100 9:19174370-19174392 CAGTCCCGGGGGAACTGGGCAGG + Intergenic
1053222525 9:36324248-36324270 CAAAACATGGGGAACTGGCTGGG + Intergenic
1053255528 9:36614005-36614027 GAGAACCAGGGCATCTGGTCAGG + Intronic
1054718687 9:68582349-68582371 CAGAACAAGGTGACCTGGCAGGG + Intergenic
1055289781 9:74770682-74770704 CCGAAGCAGGGGAACGGGACAGG - Intronic
1055746357 9:79449755-79449777 CAAAACCAAGGAAAGTGGCCGGG - Intergenic
1056484090 9:87036730-87036752 GAGAACTAGGGGAGCTGGCATGG - Intergenic
1056574336 9:87843385-87843407 AAGAGGCAGGGGACCTGGCCTGG + Intergenic
1057018988 9:91681181-91681203 CAGCAGGAGGGGACCTGGCCGGG + Intronic
1057219586 9:93248862-93248884 CAGAGCCAAGGGACCTGCCCGGG + Intronic
1058602620 9:106686805-106686827 CAAAAGAAGGGGAACTGGCAGGG + Intergenic
1058609274 9:106757342-106757364 TTGCACCTGGGGAACTGGCCAGG + Intergenic
1058917828 9:109584618-109584640 CAGGACCCTGGGAACTGGCTGGG - Intergenic
1059777377 9:117489054-117489076 CAGAAGAAGAGGAACTGGGCTGG - Intergenic
1059793180 9:117662903-117662925 TAGAGCCAGGGGAAGTGACCTGG - Intergenic
1060830408 9:126710675-126710697 AAAAAGCAGGGCAACTGGCCGGG - Intergenic
1061309808 9:129754826-129754848 CAGAACCCGGGGAAGCGGGCAGG - Intergenic
1062224748 9:135443403-135443425 TAGAAACAAGGGAACTGTCCAGG + Intergenic
1062251348 9:135596883-135596905 CAGATCCAGGGGACCTTACCTGG - Intergenic
1186218971 X:7328989-7329011 TAAAACCAGGTCAACTGGCCGGG - Intronic
1186715093 X:12243175-12243197 CAGAAACAGGTGAACAGGCCAGG - Intronic
1187242585 X:17527353-17527375 CAGAGCCAGGGAAGCTGGCAGGG - Intronic
1190060936 X:47211292-47211314 CAGAACCAGGGGTAGAGGACTGG - Intronic
1194916774 X:99717613-99717635 CAGAATCATGAGGACTGGCCTGG - Intergenic
1194945762 X:100065023-100065045 CAGAATCAGGCAGACTGGCCTGG + Intergenic
1195253982 X:103075962-103075984 CTGAACCAGGAGATCTGGCTGGG - Exonic
1196228637 X:113195069-113195091 CAGAACTGGGGTAACTGGCCTGG - Intergenic
1196669716 X:118352665-118352687 CAGAATCAGGTGAATTTGCCAGG + Intronic
1197082999 X:122441075-122441097 CAGAGCCATGGGGGCTGGCCTGG + Intergenic
1197764273 X:130049747-130049769 AAGAACATGGGGAAATGGCCAGG - Intronic