ID: 986625615

View in Genome Browser
Species Human (GRCh38)
Location 5:9721068-9721090
Sequence ATCTATTTATATAGGTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986625615_986625619 18 Left 986625615 5:9721068-9721090 CCTGCTTACCTATATAAATAGAT No data
Right 986625619 5:9721109-9721131 TTTGGCAAAAATTCTCTGACAGG No data
986625615_986625617 0 Left 986625615 5:9721068-9721090 CCTGCTTACCTATATAAATAGAT No data
Right 986625617 5:9721091-9721113 AGCTGATCAAGCCTTTTTTTTGG No data
986625615_986625620 23 Left 986625615 5:9721068-9721090 CCTGCTTACCTATATAAATAGAT No data
Right 986625620 5:9721114-9721136 CAAAAATTCTCTGACAGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986625615 Original CRISPR ATCTATTTATATAGGTAAGC AGG (reversed) Intergenic
No off target data available for this crispr