ID: 986625659

View in Genome Browser
Species Human (GRCh38)
Location 5:9721467-9721489
Sequence GACACCAGGGACTTTCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986625659_986625662 -4 Left 986625659 5:9721467-9721489 CCTGTGTGAAAGTCCCTGGTGTC No data
Right 986625662 5:9721486-9721508 TGTCCTGACTAACCCACAGTAGG No data
986625659_986625666 23 Left 986625659 5:9721467-9721489 CCTGTGTGAAAGTCCCTGGTGTC No data
Right 986625666 5:9721513-9721535 GAATGAATAGAACCTTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986625659 Original CRISPR GACACCAGGGACTTTCACAC AGG (reversed) Intergenic
No off target data available for this crispr