ID: 986627498

View in Genome Browser
Species Human (GRCh38)
Location 5:9736389-9736411
Sequence CCACTTCACAAGAGAGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986627498_986627504 20 Left 986627498 5:9736389-9736411 CCATCTGCTCTCTTGTGAAGTGG No data
Right 986627504 5:9736432-9736454 ATGCTGCTTAGGCTGAGAGTAGG No data
986627498_986627505 23 Left 986627498 5:9736389-9736411 CCATCTGCTCTCTTGTGAAGTGG No data
Right 986627505 5:9736435-9736457 CTGCTTAGGCTGAGAGTAGGTGG No data
986627498_986627500 -7 Left 986627498 5:9736389-9736411 CCATCTGCTCTCTTGTGAAGTGG No data
Right 986627500 5:9736405-9736427 GAAGTGGACCAGAAGTGTCCAGG No data
986627498_986627502 9 Left 986627498 5:9736389-9736411 CCATCTGCTCTCTTGTGAAGTGG No data
Right 986627502 5:9736421-9736443 GTCCAGGATTAATGCTGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986627498 Original CRISPR CCACTTCACAAGAGAGCAGA TGG (reversed) Intergenic
No off target data available for this crispr