ID: 986631088

View in Genome Browser
Species Human (GRCh38)
Location 5:9774998-9775020
Sequence TTCTGTCCTTCCCTTTAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986631083_986631088 20 Left 986631083 5:9774955-9774977 CCCTAGGGCTCTACAATCAGCAG 0: 38
1: 197
2: 332
3: 408
4: 742
Right 986631088 5:9774998-9775020 TTCTGTCCTTCCCTTTAGGGTGG No data
986631084_986631088 19 Left 986631084 5:9774956-9774978 CCTAGGGCTCTACAATCAGCAGC No data
Right 986631088 5:9774998-9775020 TTCTGTCCTTCCCTTTAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986631088 Original CRISPR TTCTGTCCTTCCCTTTAGGG TGG Intergenic
No off target data available for this crispr