ID: 986631304

View in Genome Browser
Species Human (GRCh38)
Location 5:9776246-9776268
Sequence AGGGAGAGTGCAGTGACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986631304_986631305 -8 Left 986631304 5:9776246-9776268 CCTGTAGTCACTGCACTCTCCCT No data
Right 986631305 5:9776261-9776283 CTCTCCCTCCCCCAAGTGCATGG No data
986631304_986631313 25 Left 986631304 5:9776246-9776268 CCTGTAGTCACTGCACTCTCCCT No data
Right 986631313 5:9776294-9776316 CATGCCACATGCCCACTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986631304 Original CRISPR AGGGAGAGTGCAGTGACTAC AGG (reversed) Intergenic
No off target data available for this crispr