ID: 986637957

View in Genome Browser
Species Human (GRCh38)
Location 5:9842653-9842675
Sequence CCAGCTACTAAGCTGATTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986637951_986637957 22 Left 986637951 5:9842608-9842630 CCACTGTGCCCAGCACAGTCTGT No data
Right 986637957 5:9842653-9842675 CCAGCTACTAAGCTGATTTGTGG No data
986637953_986637957 13 Left 986637953 5:9842617-9842639 CCAGCACAGTCTGTCTTTTGAAG No data
Right 986637957 5:9842653-9842675 CCAGCTACTAAGCTGATTTGTGG No data
986637952_986637957 14 Left 986637952 5:9842616-9842638 CCCAGCACAGTCTGTCTTTTGAA No data
Right 986637957 5:9842653-9842675 CCAGCTACTAAGCTGATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986637957 Original CRISPR CCAGCTACTAAGCTGATTTG TGG Intergenic
No off target data available for this crispr