ID: 986638338

View in Genome Browser
Species Human (GRCh38)
Location 5:9847268-9847290
Sequence TGTTATGTAAGATCAGGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986638338_986638346 24 Left 986638338 5:9847268-9847290 CCTATGCCTGATCTTACATAACA No data
Right 986638346 5:9847315-9847337 CTTTTTTAAAAAAGTTCTTTGGG No data
986638338_986638345 23 Left 986638338 5:9847268-9847290 CCTATGCCTGATCTTACATAACA No data
Right 986638345 5:9847314-9847336 CCTTTTTTAAAAAAGTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986638338 Original CRISPR TGTTATGTAAGATCAGGCAT AGG (reversed) Intergenic
No off target data available for this crispr