ID: 986647096

View in Genome Browser
Species Human (GRCh38)
Location 5:9928115-9928137
Sequence GCAGCTCTAGAGAGTGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986647094_986647096 1 Left 986647094 5:9928091-9928113 CCAGGGGCTGCCATATTGATCAG No data
Right 986647096 5:9928115-9928137 GCAGCTCTAGAGAGTGAATCAGG No data
986647095_986647096 -9 Left 986647095 5:9928101-9928123 CCATATTGATCAGAGCAGCTCTA No data
Right 986647096 5:9928115-9928137 GCAGCTCTAGAGAGTGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986647096 Original CRISPR GCAGCTCTAGAGAGTGAATC AGG Intergenic
No off target data available for this crispr