ID: 986647245

View in Genome Browser
Species Human (GRCh38)
Location 5:9929531-9929553
Sequence TGGGACTCAGAGGGAAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986647238_986647245 26 Left 986647238 5:9929482-9929504 CCATTGATCCACAGAGAGCATTT No data
Right 986647245 5:9929531-9929553 TGGGACTCAGAGGGAAAATCAGG No data
986647239_986647245 18 Left 986647239 5:9929490-9929512 CCACAGAGAGCATTTTTAGTGCA No data
Right 986647245 5:9929531-9929553 TGGGACTCAGAGGGAAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986647245 Original CRISPR TGGGACTCAGAGGGAAAATC AGG Intergenic
No off target data available for this crispr