ID: 986648408

View in Genome Browser
Species Human (GRCh38)
Location 5:9940727-9940749
Sequence CTGTAGGACTTCAGGCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986648408_986648413 26 Left 986648408 5:9940727-9940749 CCAACTTGCCTGAAGTCCTACAG No data
Right 986648413 5:9940776-9940798 CTAGACAAAGCAAGTGCTGCGGG No data
986648408_986648412 25 Left 986648408 5:9940727-9940749 CCAACTTGCCTGAAGTCCTACAG No data
Right 986648412 5:9940775-9940797 CCTAGACAAAGCAAGTGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986648408 Original CRISPR CTGTAGGACTTCAGGCAAGT TGG (reversed) Intergenic
No off target data available for this crispr