ID: 986650571

View in Genome Browser
Species Human (GRCh38)
Location 5:9959492-9959514
Sequence CTATTGCCAAAGATGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986650562_986650571 8 Left 986650562 5:9959461-9959483 CCCACAGCATAGCTAACGAGCAG No data
Right 986650571 5:9959492-9959514 CTATTGCCAAAGATGGAGGGAGG No data
986650563_986650571 7 Left 986650563 5:9959462-9959484 CCACAGCATAGCTAACGAGCAGG No data
Right 986650571 5:9959492-9959514 CTATTGCCAAAGATGGAGGGAGG No data
986650561_986650571 28 Left 986650561 5:9959441-9959463 CCAAACAATAAAAGTTACTACCC No data
Right 986650571 5:9959492-9959514 CTATTGCCAAAGATGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986650571 Original CRISPR CTATTGCCAAAGATGGAGGG AGG Intergenic
No off target data available for this crispr