ID: 986650889

View in Genome Browser
Species Human (GRCh38)
Location 5:9962347-9962369
Sequence ATGTGTTGAGGGAGGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986650889_986650900 12 Left 986650889 5:9962347-9962369 CCTCCTTTCCTCCCTCAACACAT No data
Right 986650900 5:9962382-9962404 TCGAGATGAGATTTGGGTGGAGG 0: 17
1: 235
2: 483
3: 465
4: 839
986650889_986650898 6 Left 986650889 5:9962347-9962369 CCTCCTTTCCTCCCTCAACACAT No data
Right 986650898 5:9962376-9962398 TACAATTCGAGATGAGATTTGGG 0: 403
1: 8457
2: 12329
3: 9573
4: 6505
986650889_986650899 9 Left 986650889 5:9962347-9962369 CCTCCTTTCCTCCCTCAACACAT No data
Right 986650899 5:9962379-9962401 AATTCGAGATGAGATTTGGGTGG 0: 391
1: 9076
2: 12924
3: 9942
4: 7736
986650889_986650897 5 Left 986650889 5:9962347-9962369 CCTCCTTTCCTCCCTCAACACAT No data
Right 986650897 5:9962375-9962397 TTACAATTCGAGATGAGATTTGG 0: 355
1: 3839
2: 11950
3: 12661
4: 10322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986650889 Original CRISPR ATGTGTTGAGGGAGGAAAGG AGG (reversed) Intergenic
No off target data available for this crispr