ID: 986651750

View in Genome Browser
Species Human (GRCh38)
Location 5:9970945-9970967
Sequence CAGGCTCACCTCAGGCACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986651738_986651750 19 Left 986651738 5:9970903-9970925 CCTACCTGCAAAGGAGGCAACTC No data
Right 986651750 5:9970945-9970967 CAGGCTCACCTCAGGCACCCCGG No data
986651734_986651750 30 Left 986651734 5:9970892-9970914 CCCGTGGAGTGCCTACCTGCAAA No data
Right 986651750 5:9970945-9970967 CAGGCTCACCTCAGGCACCCCGG No data
986651741_986651750 -3 Left 986651741 5:9970925-9970947 CCGCATGCACCCCCAGGACCCAG No data
Right 986651750 5:9970945-9970967 CAGGCTCACCTCAGGCACCCCGG No data
986651735_986651750 29 Left 986651735 5:9970893-9970915 CCGTGGAGTGCCTACCTGCAAAG No data
Right 986651750 5:9970945-9970967 CAGGCTCACCTCAGGCACCCCGG No data
986651739_986651750 15 Left 986651739 5:9970907-9970929 CCTGCAAAGGAGGCAACTCCGCA No data
Right 986651750 5:9970945-9970967 CAGGCTCACCTCAGGCACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986651750 Original CRISPR CAGGCTCACCTCAGGCACCC CGG Intergenic
No off target data available for this crispr