ID: 986652638

View in Genome Browser
Species Human (GRCh38)
Location 5:9979638-9979660
Sequence GGCTTCCTAGAGAAGCCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986652635_986652638 1 Left 986652635 5:9979614-9979636 CCATCACATATTAAGAAGAAAGG No data
Right 986652638 5:9979638-9979660 GGCTTCCTAGAGAAGCCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986652638 Original CRISPR GGCTTCCTAGAGAAGCCTAA TGG Intergenic