ID: 986652638 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:9979638-9979660 |
Sequence | GGCTTCCTAGAGAAGCCTAA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
986652635_986652638 | 1 | Left | 986652635 | 5:9979614-9979636 | CCATCACATATTAAGAAGAAAGG | No data | ||
Right | 986652638 | 5:9979638-9979660 | GGCTTCCTAGAGAAGCCTAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
986652638 | Original CRISPR | GGCTTCCTAGAGAAGCCTAA TGG | Intergenic | ||