ID: 986653547

View in Genome Browser
Species Human (GRCh38)
Location 5:9988721-9988743
Sequence CCATATGGATGCTGGAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986653540_986653547 13 Left 986653540 5:9988685-9988707 CCCTTTCAAAATTAGCTCCAGGT No data
Right 986653547 5:9988721-9988743 CCATATGGATGCTGGAAAATTGG No data
986653541_986653547 12 Left 986653541 5:9988686-9988708 CCTTTCAAAATTAGCTCCAGGTG No data
Right 986653547 5:9988721-9988743 CCATATGGATGCTGGAAAATTGG No data
986653542_986653547 -4 Left 986653542 5:9988702-9988724 CCAGGTGACCAAAGAAAATCCAT No data
Right 986653547 5:9988721-9988743 CCATATGGATGCTGGAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986653547 Original CRISPR CCATATGGATGCTGGAAAAT TGG Intergenic
No off target data available for this crispr