ID: 986661011

View in Genome Browser
Species Human (GRCh38)
Location 5:10060248-10060270
Sequence CCAGCCAAGCTCTACCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986661007_986661011 28 Left 986661007 5:10060197-10060219 CCACAAATGATGTGAAATTACGG No data
Right 986661011 5:10060248-10060270 CCAGCCAAGCTCTACCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986661011 Original CRISPR CCAGCCAAGCTCTACCATGA AGG Intergenic
No off target data available for this crispr