ID: 986661578

View in Genome Browser
Species Human (GRCh38)
Location 5:10064719-10064741
Sequence GGCCACCAGGAGGACCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986661578_986661583 -10 Left 986661578 5:10064719-10064741 CCTTCAGGGTCCTCCTGGTGGCC No data
Right 986661583 5:10064732-10064754 CCTGGTGGCCAGGGCCCCTGCGG No data
986661578_986661591 25 Left 986661578 5:10064719-10064741 CCTTCAGGGTCCTCCTGGTGGCC No data
Right 986661591 5:10064767-10064789 GTAACTAAGCTCAGGGGCGCTGG No data
986661578_986661589 18 Left 986661578 5:10064719-10064741 CCTTCAGGGTCCTCCTGGTGGCC No data
Right 986661589 5:10064760-10064782 TTGAGCAGTAACTAAGCTCAGGG No data
986661578_986661590 19 Left 986661578 5:10064719-10064741 CCTTCAGGGTCCTCCTGGTGGCC No data
Right 986661590 5:10064761-10064783 TGAGCAGTAACTAAGCTCAGGGG No data
986661578_986661588 17 Left 986661578 5:10064719-10064741 CCTTCAGGGTCCTCCTGGTGGCC No data
Right 986661588 5:10064759-10064781 TTTGAGCAGTAACTAAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986661578 Original CRISPR GGCCACCAGGAGGACCCTGA AGG (reversed) Intergenic
No off target data available for this crispr