ID: 986661583

View in Genome Browser
Species Human (GRCh38)
Location 5:10064732-10064754
Sequence CCTGGTGGCCAGGGCCCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986661575_986661583 -8 Left 986661575 5:10064717-10064739 CCCCTTCAGGGTCCTCCTGGTGG No data
Right 986661583 5:10064732-10064754 CCTGGTGGCCAGGGCCCCTGCGG No data
986661568_986661583 11 Left 986661568 5:10064698-10064720 CCAGGTGGCTGTCCCCGGACCCC No data
Right 986661583 5:10064732-10064754 CCTGGTGGCCAGGGCCCCTGCGG No data
986661573_986661583 -3 Left 986661573 5:10064712-10064734 CCGGACCCCTTCAGGGTCCTCCT No data
Right 986661583 5:10064732-10064754 CCTGGTGGCCAGGGCCCCTGCGG No data
986661578_986661583 -10 Left 986661578 5:10064719-10064741 CCTTCAGGGTCCTCCTGGTGGCC No data
Right 986661583 5:10064732-10064754 CCTGGTGGCCAGGGCCCCTGCGG No data
986661571_986661583 -1 Left 986661571 5:10064710-10064732 CCCCGGACCCCTTCAGGGTCCTC No data
Right 986661583 5:10064732-10064754 CCTGGTGGCCAGGGCCCCTGCGG No data
986661577_986661583 -9 Left 986661577 5:10064718-10064740 CCCTTCAGGGTCCTCCTGGTGGC No data
Right 986661583 5:10064732-10064754 CCTGGTGGCCAGGGCCCCTGCGG No data
986661565_986661583 20 Left 986661565 5:10064689-10064711 CCAGTGCTCCCAGGTGGCTGTCC No data
Right 986661583 5:10064732-10064754 CCTGGTGGCCAGGGCCCCTGCGG No data
986661567_986661583 12 Left 986661567 5:10064697-10064719 CCCAGGTGGCTGTCCCCGGACCC No data
Right 986661583 5:10064732-10064754 CCTGGTGGCCAGGGCCCCTGCGG No data
986661572_986661583 -2 Left 986661572 5:10064711-10064733 CCCGGACCCCTTCAGGGTCCTCC No data
Right 986661583 5:10064732-10064754 CCTGGTGGCCAGGGCCCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986661583 Original CRISPR CCTGGTGGCCAGGGCCCCTG CGG Intergenic
No off target data available for this crispr