ID: 986661588

View in Genome Browser
Species Human (GRCh38)
Location 5:10064759-10064781
Sequence TTTGAGCAGTAACTAAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986661572_986661588 25 Left 986661572 5:10064711-10064733 CCCGGACCCCTTCAGGGTCCTCC No data
Right 986661588 5:10064759-10064781 TTTGAGCAGTAACTAAGCTCAGG No data
986661581_986661588 7 Left 986661581 5:10064729-10064751 CCTCCTGGTGGCCAGGGCCCCTG No data
Right 986661588 5:10064759-10064781 TTTGAGCAGTAACTAAGCTCAGG No data
986661573_986661588 24 Left 986661573 5:10064712-10064734 CCGGACCCCTTCAGGGTCCTCCT No data
Right 986661588 5:10064759-10064781 TTTGAGCAGTAACTAAGCTCAGG No data
986661584_986661588 -4 Left 986661584 5:10064740-10064762 CCAGGGCCCCTGCGGACAGTTTG No data
Right 986661588 5:10064759-10064781 TTTGAGCAGTAACTAAGCTCAGG No data
986661578_986661588 17 Left 986661578 5:10064719-10064741 CCTTCAGGGTCCTCCTGGTGGCC No data
Right 986661588 5:10064759-10064781 TTTGAGCAGTAACTAAGCTCAGG No data
986661575_986661588 19 Left 986661575 5:10064717-10064739 CCCCTTCAGGGTCCTCCTGGTGG No data
Right 986661588 5:10064759-10064781 TTTGAGCAGTAACTAAGCTCAGG No data
986661571_986661588 26 Left 986661571 5:10064710-10064732 CCCCGGACCCCTTCAGGGTCCTC No data
Right 986661588 5:10064759-10064781 TTTGAGCAGTAACTAAGCTCAGG No data
986661577_986661588 18 Left 986661577 5:10064718-10064740 CCCTTCAGGGTCCTCCTGGTGGC No data
Right 986661588 5:10064759-10064781 TTTGAGCAGTAACTAAGCTCAGG No data
986661582_986661588 4 Left 986661582 5:10064732-10064754 CCTGGTGGCCAGGGCCCCTGCGG No data
Right 986661588 5:10064759-10064781 TTTGAGCAGTAACTAAGCTCAGG No data
986661585_986661588 -10 Left 986661585 5:10064746-10064768 CCCCTGCGGACAGTTTGAGCAGT No data
Right 986661588 5:10064759-10064781 TTTGAGCAGTAACTAAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986661588 Original CRISPR TTTGAGCAGTAACTAAGCTC AGG Intergenic
No off target data available for this crispr