ID: 986661589

View in Genome Browser
Species Human (GRCh38)
Location 5:10064760-10064782
Sequence TTGAGCAGTAACTAAGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986661582_986661589 5 Left 986661582 5:10064732-10064754 CCTGGTGGCCAGGGCCCCTGCGG No data
Right 986661589 5:10064760-10064782 TTGAGCAGTAACTAAGCTCAGGG No data
986661577_986661589 19 Left 986661577 5:10064718-10064740 CCCTTCAGGGTCCTCCTGGTGGC No data
Right 986661589 5:10064760-10064782 TTGAGCAGTAACTAAGCTCAGGG No data
986661585_986661589 -9 Left 986661585 5:10064746-10064768 CCCCTGCGGACAGTTTGAGCAGT No data
Right 986661589 5:10064760-10064782 TTGAGCAGTAACTAAGCTCAGGG No data
986661586_986661589 -10 Left 986661586 5:10064747-10064769 CCCTGCGGACAGTTTGAGCAGTA No data
Right 986661589 5:10064760-10064782 TTGAGCAGTAACTAAGCTCAGGG No data
986661575_986661589 20 Left 986661575 5:10064717-10064739 CCCCTTCAGGGTCCTCCTGGTGG No data
Right 986661589 5:10064760-10064782 TTGAGCAGTAACTAAGCTCAGGG No data
986661573_986661589 25 Left 986661573 5:10064712-10064734 CCGGACCCCTTCAGGGTCCTCCT No data
Right 986661589 5:10064760-10064782 TTGAGCAGTAACTAAGCTCAGGG No data
986661572_986661589 26 Left 986661572 5:10064711-10064733 CCCGGACCCCTTCAGGGTCCTCC No data
Right 986661589 5:10064760-10064782 TTGAGCAGTAACTAAGCTCAGGG No data
986661571_986661589 27 Left 986661571 5:10064710-10064732 CCCCGGACCCCTTCAGGGTCCTC No data
Right 986661589 5:10064760-10064782 TTGAGCAGTAACTAAGCTCAGGG No data
986661581_986661589 8 Left 986661581 5:10064729-10064751 CCTCCTGGTGGCCAGGGCCCCTG No data
Right 986661589 5:10064760-10064782 TTGAGCAGTAACTAAGCTCAGGG No data
986661584_986661589 -3 Left 986661584 5:10064740-10064762 CCAGGGCCCCTGCGGACAGTTTG No data
Right 986661589 5:10064760-10064782 TTGAGCAGTAACTAAGCTCAGGG No data
986661578_986661589 18 Left 986661578 5:10064719-10064741 CCTTCAGGGTCCTCCTGGTGGCC No data
Right 986661589 5:10064760-10064782 TTGAGCAGTAACTAAGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986661589 Original CRISPR TTGAGCAGTAACTAAGCTCA GGG Intergenic
No off target data available for this crispr