ID: 986661591

View in Genome Browser
Species Human (GRCh38)
Location 5:10064767-10064789
Sequence GTAACTAAGCTCAGGGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986661578_986661591 25 Left 986661578 5:10064719-10064741 CCTTCAGGGTCCTCCTGGTGGCC No data
Right 986661591 5:10064767-10064789 GTAACTAAGCTCAGGGGCGCTGG No data
986661577_986661591 26 Left 986661577 5:10064718-10064740 CCCTTCAGGGTCCTCCTGGTGGC No data
Right 986661591 5:10064767-10064789 GTAACTAAGCTCAGGGGCGCTGG No data
986661582_986661591 12 Left 986661582 5:10064732-10064754 CCTGGTGGCCAGGGCCCCTGCGG No data
Right 986661591 5:10064767-10064789 GTAACTAAGCTCAGGGGCGCTGG No data
986661584_986661591 4 Left 986661584 5:10064740-10064762 CCAGGGCCCCTGCGGACAGTTTG No data
Right 986661591 5:10064767-10064789 GTAACTAAGCTCAGGGGCGCTGG No data
986661575_986661591 27 Left 986661575 5:10064717-10064739 CCCCTTCAGGGTCCTCCTGGTGG No data
Right 986661591 5:10064767-10064789 GTAACTAAGCTCAGGGGCGCTGG No data
986661586_986661591 -3 Left 986661586 5:10064747-10064769 CCCTGCGGACAGTTTGAGCAGTA No data
Right 986661591 5:10064767-10064789 GTAACTAAGCTCAGGGGCGCTGG No data
986661581_986661591 15 Left 986661581 5:10064729-10064751 CCTCCTGGTGGCCAGGGCCCCTG No data
Right 986661591 5:10064767-10064789 GTAACTAAGCTCAGGGGCGCTGG No data
986661585_986661591 -2 Left 986661585 5:10064746-10064768 CCCCTGCGGACAGTTTGAGCAGT No data
Right 986661591 5:10064767-10064789 GTAACTAAGCTCAGGGGCGCTGG No data
986661587_986661591 -4 Left 986661587 5:10064748-10064770 CCTGCGGACAGTTTGAGCAGTAA No data
Right 986661591 5:10064767-10064789 GTAACTAAGCTCAGGGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986661591 Original CRISPR GTAACTAAGCTCAGGGGCGC TGG Intergenic
No off target data available for this crispr