ID: 986664799

View in Genome Browser
Species Human (GRCh38)
Location 5:10091945-10091967
Sequence TCTTGGGACTCCTACTGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986664799_986664802 6 Left 986664799 5:10091945-10091967 CCGCTGCAGTAGGAGTCCCAAGA No data
Right 986664802 5:10091974-10091996 AAAGAGCAAGCTCCACTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986664799 Original CRISPR TCTTGGGACTCCTACTGCAG CGG (reversed) Intergenic
No off target data available for this crispr